Purified DNA was sheared to ∼150 bp fragments (Covaris S220) and concentrated (NucleoSpin Gel and PCR Clean-up Kit, Macherey-Nagel). Then, 0.5–1 µg (determined by Qubit, Thermo Fisher Scientific) was used for library preparation: DNA end polishing (15 units T4 DNA Polymerase, 50 units T4 PNK, 5 units Klenow [NEB]) for 30 min at 20°C, DNA purification with AmPure XP beads (Beckman Coulter), A-tailing (15 units Klenow exo-[NEB]) for 30 min at 37°C, AmPure XP bead purification, adapter ligation (15 units T4 DNA Ligase [NEB], 75–150 pmol NEBNext Adapter or NEBNext Methylated Adapter for bisulfite conversion) for 20 min at 25°C, AmPure XP bead purification, PCR (only for half of the sample, 8 PCR cycles with NEBNext Multiplex Primers for Illumina and Phusion Polymerase [NEB]). Methylated samples were either bisulfite converted (Qiagen EpiTect Bisulfite Kit) and subjected to 12–14 PCR cycles (NEBNext Multiplex Primers for Illumina and Phusion U Polymerase, Thermo Fisher Scientific), or treated with the Enzymatic Methyl-Kit (NEB, E7120S). All samples were sequenced on an Illumina HiSeq 1500 in 50-bp paired-end mode.
Ampure xp bead
Manufactured by Illumina
Sourced in United States, China
AMPure XP beads are a paramagnetic bead-based nucleic acid purification solution used for the purification of DNA and RNA from various sample types. The beads selectively bind nucleic acids, allowing for the removal of contaminants and salts during the purification process.
Automatically generated - may contain errors
Lab products found in correlation
Ampure xp bead, by Beckman Coulter (22 mentions)
Miseq platform, by Illumina (8 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (7 mentions)
Nextseq 500, by Illumina (6 mentions)
Hiseq 2000, by Illumina (5 mentions)
Hotstartaq plus master mix kit, by Qiagen (5 mentions)
Truseq, by Illumina (5 mentions)
Novaseq 6000, by Illumina (4 mentions)
Kapa hifi hotstart readymix, by Roche (4 mentions)
Nebnext dna library prep kit, by New England Biolabs (3 mentions)
Ez dna methylation lightning kit, by Beckman Coulter (3 mentions)
Truseq stranded mrna library prep kit, by Illumina (3 mentions)
Sureselect hybrid capture kit whole exome v4, by Agilent Technologies (3 mentions)
Hiseq 2500 system, by Illumina (3 mentions)
Hiseq 2500, by Illumina (3 mentions)
Human all exon v2 44 mb bait set, by Agilent Technologies (3 mentions)
Trizol reagent kit, by Thermo Fisher Scientific (3 mentions)
Dneasy blood and tissue kit, by Qiagen (2 mentions)
Nextseq 500 platform, by Illumina (2 mentions)
Reliaprep rna cell miniprep system, by Promega (2 mentions)
89 protocols using ampure xp bead
1
Genome-wide DNA Methylation Analysis Protocol
2
Prep and Sequencing of Integrated Libraries
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Tapestri User Guide V2 was followed to prepare the libraries, with a few modifications listed here. Briefly, PCR products were retrieved from individual droplets and purified with 0.7X Ampure XP beads (Beckman Coulter; Cat. num. A63881), to split the scTAM-seq library bound to the beads from the surface-protein library in the supernatant. Illumina i5/i7 sequencing indexes were added to the scTAM-seq PCR products, followed by two steps of purification, using 0.69X and 0.65X Ampure XP beads (these are different from the ratios indicated in the Tapestri User Guide V2). PCR products from the surface-protein library were incubated with Tapestri Biotin Oligo at 96 °C for 5 min, followed by incubation on ice for 5 min, and purified using Tapestri Streptavidin beads. Afterwards, the beads were used as PCR templates for the incorporation of i5/i7 Illumina indices, followed by purification using 0.9X Ampure XP beads. The quality of all scTAM-seq and surface-protein libraries were assessed by Bioanalyzer (Additional file 1 : Fig. S16). Libraries were pooled and sequenced on the Illumina NovaSeq 6000 platform, at the CNAG-CRG Sequencing Unit, read length 2 × 150 cycles, at a sequencing depth of 260 M reads/library in case of surface-protein libraries, and 420 M aligned reads/library for scTAM-seq libraries (Additional file 3 : Table S2).
3
Dual gRNA Amplification and Sequencing
4
Examining DNA Methylation Dynamics in Tet3 Knockout Mouse ESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tet3+/+, Tet3m/m and Tet3–/– mouse ESCs were differentiated to NE (-LIF + RA for 3 days). DNA was extracted and subjected to hMeDIP (Active Motif hMeDIP Kit #55010) following manufacturer guidelines, and amplified using NEBNext HiFi 2x PCR Master mix. Libraries were cleaned with AMPure XP beads (#A63880) and subjected to 75 bp paired-end sequencing using Illumina NextSeq 500 platform at the Einstein Epigenomics Core. Adapters were trimmed using TrimGalore and sequencing reads were mapped to the mouse genome (mm10) using bowtie2 (v2.4.5)50 (link) with the following parameters: --local --sensitive --very-sensitive-local --no-unal --no-mixed --no-discordant –phred33 -I 10 -X 700. The BAM files were balanced to the sample with the lowest reads using samtools and were used to call peaks using MACS2 (v2.2.7.1)51 (link) with the following parameters: -p 0.0001 -f BAMPE --keep-dup all. BED files with genomic coordinates were annotated using ChIPseeker (v1.36.0). IgG bigwig was subtracted from Tet3+/+, Tet3m/m and Tet3–/– bigwigs using function bigwigCompare --operation subtract from deepTools. The output bigwig files were used to make line plots using function plotProfile from deepTools.
5
Placental DNA Methylation Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The placental samples were frozen immediately after birth. DNA was extracted using Qiagen’s Puregene kit, sonicated to ~300 bp, and methylated Illumina adapters were ligated to the ends using NEB’s NEBNext DNA library prep kit. The library was bisulfite-converted using Zymo’s EZ DNA Methylation-Lightning Kit, amplified for 14 cycles using PfuTurbo Cx, purified with Agencourt AMPure XP beads, and sequenced on an Illumina HiSeq 2000. Reads were mapped to the hg19 version of the human genome using BS Seeker [22 (link)]. To eliminate clonal PCR amplification duplicates, only one read out of those with identical genomic positions was kept; Genome and CpG coverage was estimated by multiplying the number and the length of the mapped reads and dividing by the size of the human genome (Additional file 1 : Table S1). CpG site methylation data were combined from both DNA strands.
6
Placental DNA Methylome Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Placenta samples were frozen immediately after birth. As previously described [20 (link)], 5-μg placental DNA was extracted, sonicated to ∼300 bp, and methylated Illumina adapters were ligated to the ends using NEB’s NEBNext DNA library prep kit. The library was bisulfite converted using Zymo’s EZ DNA Methylation-Lightning Kit, amplified for 14 cycles using PfuTurbo Cx, purified with Agencourt AMPure XP beads, and sequenced on an Illumina HiSeq 2000. Laboratory personnel were blinded to the case status of the samples, and samples were arranged randomly. Reads were mapped to the hg19 version of the human genome using BS Seeker [50 (link)]. To prevent clonal PCR amplification biases, only one read out of those with identical genomic positions was kept. CpG site methylation data were combined from both DNA strands. Sequencing information for each placenta sample, including the total reads, total mapped reads, coverage, and conversion efficiency is provided in Table S9.
7
Influenza Viral RNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was obtained from 140 µl of the original sample, or after amplification in MDCK cells, using the QIAamp Viral RNA minikit QIAGEN). Next, 5 µl of viral RNA were used as template in a 50 µl multi-segment RT-PCR reaction (Superscript III high-fidelity RT-PCR kit) with influenza-specific universal primers complementary to the conserved 12–13 nucleotides at the end of all 8 genomic segments. Primer sequences and final concentrations in the reaction were as follows (influenza-complementary sequences are underlined): Opti1-F1 – 5’ GTTACGCGCCAGCAAAAGCAGG (0.1 μM); Opti1-F2 - 5’ GTTACGCGCCAGCGAAAGCAGG (0.1 μM); Opti1-R1 - 5’ GTTACGCGCCAGTAGAAACAAGG (0.2 μM). Amplicons were purified with 0.45x volume AMPure XP beads (Beckman Coulter) and 0.5–1 µg was sheared to an average fragment size of 150 bp on a Bioruptor Pico sonicator (Diagenode). Next, amplicon sequence libraries were prepared using the end repair, A-tailing, and adaptor ligation NEBNext DNA library prep modules for Illumina from New England Biolabs according to the manufacturer’s protocol. Following final size-selection with 1x volume AMPure XP beads, and secondary PCR (8 cycles) to introduce barcoded primers, multiplexed libraries were sequenced on the Illumina HiSeq 2500 platform in a single-end 100 nt run format.
8
Cell-Type Specific Translating RNAs Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 2 or 14 d post-LPS/HI mouse brains were harvested in ice-cold dissection buffer following previously described procedures to purify the cell-type specific translating RNAs 35 (link). The rabbit anti-GFP antibodies, chromatin immunoprecipitation (ChIP) grade (#ab290, Abcam), were used for immunopurification. The purification specificity from CCR2-TRAP mice has been characterized 9 (link). The cDNA library was generated with a TruSeq Stranded mRNA Library Prep Kit (Illumina) with Agencourt AMPure XP beads for PCR cleanup. Samples were loaded onto a NextSeq 500 mid-output 150 cycle cartridge and sequenced on a NextSeq 500 (Illumina).
9
Smart-seq2 RNA-seq from sorted cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from 8,000-300,000 sorted cells with the ReliaPrep RNA Cell Miniprep System (Promega). Sequencing libraries were generated using the Smart-seq2 method50 (link). Briefly, 5 ng of RNA were retrotranscribed and cDNA was amplified using 15 PCR cycles and purified with AMPure XP beads (Beckman Coulter). After purification, the concentration was determined using Qubit 3.0 (Life Technologies) and the size distribution was assessed using Agilent 4200 TapeStation system. Then, the tagmentation reaction was performed starting from 0.5 ng of cDNA for 30 minutes at 55°C and the enrichment PCR was carried out using 12 cycles. Libraries were then purified with AMPure XP beads, quantified using Qubit 3.0 and single-end sequenced (75 bp) on an Illumina NextSeq 500.
10
CHD4 Chromatin Profiling in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H9 cells and in vitro differentiated cells at different stages were harvested and gently homogenized with pestle A. Cells were then washed twice in 1.5 mL Wash Buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1 × Protease inhibitor cocktail, EDTA free), immobilized to concanavalin A coated magnetic beads (Bangs Laboratories), and then resuspended in 50 μl Dig-wash Buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1 × Protease inhibitor cocktail, 0.05% Digitonin) containing 2 mM EDTA85 (link). After sequential incubation with antibodies to CHD4 (Abcam, #ab72418, diluted 1:50 in 50 μl of Dig-Wash buffer), secondary antibodies (diluted 1:100 in 100 μl of Dig-Wash buffer) and a 1:200 dilution of pAG-Tn5 (gift from S. Henikoff) in Dig-300 Buffer (0.05% digitonin, 20 mM HEPES, pH7.5, 300 mM NaCl, 0.5 mM Spermidine, 1 × Protease inhibitor cocktail), bead-bound cells were resuspended in 50 μl tagmentation buffer (10 mM MgCl2 in Dig-wash Buffer). The tagmented DNA was cleaned with 1.5 × Ampure XP beads (Beckman Counter), amplified with Illumina Nextera barcoded primers, and purified by 1.1 × Ampure XP beads for sequencing in a Novaseq 6000 instrument.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!