Total RNA was isolated and purified using RNAiso plus (Takara, Japan) and transcribed into cDNA using the first strand cDNA synthesis kit (TOYOBO, Japan). The cDNA was diluted for the real-time quantitative PCR (qRT-PCR), and the samples were run in a 10μl reaction system using the SYBR GREEN qPCR mix (TOYOBO, Japan). The data were detected using the ABI CFX Connect TM Real-Time PCR Detection System (ABI, USA). The level of mRNA in each sample was normalized with respect to 36B4 as the internal standard.
Sybr green qpcr mix
Manufactured by Toyobo
Sourced in Japan, China, United States
The SYBR Green qPCR Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains SYBR Green I dye, DNA polymerase, and necessary buffers and reagents. The mix is designed to enable sensitive and reliable quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (22 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (4 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
7300 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Abi 7300 instrument, by Thermo Fisher Scientific (2 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
First strand cdna synthesis kit, by Toyobo (1 mentions)
Qpcr rt kit, by Toyobo (1 mentions)
Cdna synthesis kit, by Toyobo (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Abi prism 7500 device, by Thermo Fisher Scientific (1 mentions)
Cfx384 real time system, by Toyobo (1 mentions)
Superscript 3 first strand synthesis system for reverse transcription pcr, by Thermo Fisher Scientific (1 mentions)
Goscript reverse transcription system, by Promega (1 mentions)
Cfx384 real time system, by Bio-Rad (1 mentions)
Primestar dna polymerase, by Takara Bio (1 mentions)
37 protocols using sybr green qpcr mix
1
Total RNA Isolation and qRT-PCR Analysis
2
Quantitative PCR Analysis of hBMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
hBMSCs were harvested at assigned time points post osteogenic induction. Total RNA was extracted using TRIzol Reagent (Life Technologies, Gaithersburg, MD, USA) according to manufacturer’s instruction. Reverse transcription was performed using the qPCR RT Kit (TOYOBO, Co. Ltd., Osaka, Japan) according to manufacturer’s instructions. mRNA levels of target genes were measured using quantitative PCR (qPCR) analysis with SYBR® Green qPCR Mix (TOYOBO Co. Ltd., Osaka, Japan). The quantitative assay was performed in a 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and the following PCR cycling protocol was used: 95 °C for 1 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The relative expression of gene-specific products was analyzed using the 2−△△CT method and normalized to the corresponding GAPDH values. The primer sequences used are shown in Table 2 .
3
Quantifying HIF-2α Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the tissues was extracted by TRIzol reagent (Invitrogen). The expression of HIF-2α (EPAS1) was then determined using SYBR Green qPCR Mix (Toyobo, Shanghai, China). Primer sequences were as follows: EPAS1 Forward: 5’-TTGCTCTGAAAACGAGTCCGA-3’, EPAS1 Reverse: 5’-GGTCACCACGGCAATGAAAC-3’. GAPDH Forward: 5’-GAGAAGGCTGGGGCTCATTT-3’, GAPDH Reverse: 5’-TAAGCAGTTGGTGGTGCAGG-3’. Relative mRNA expression was calculated using the 2−ΔΔCT method, and GAPDH was used as an internal control.
4
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using RNAiso plus (TaKaRa, Japan), and the cDNA synthesis was conducted using a cDNA synthesis kit (TOYOBO, Japan). Quantitative real-time PCR (qRT-PCR) was performed using the SYBR GREEN qPCR mix (TOYOBO, Japan) according to the manufacturer’s instructions. The data were detected by using the ABI CFX Connect TM Real-Time PCR Detection System (ABI, USA). The ΔΔCT method was calculated to obtain the fold expression levels. The primer pairs for quantitative real-time PCR were listed in Table S2 .
5
Quantifying Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cell pellets using Trizol reagent (Invitrogen, USA) and reversely transcribed using PrimeScript RT Reagent Kit (Takara Bio Inc.). The expression levels of interested genes were measured in triplicate using SYBR Green qPCR Mix (Toyobo, China). Primer sequences were as follows. ITM2A Forward: 5´-ATCCTGCAAATTCCCTTCGTG-3´, Reverse: 5´- CAGGTAAGCAGTCATTCCCTTT-3´; PD-L1 Forward: 5´- CTGTCACGGTTCCCAAGGAC -3´, Reverse: 5´-GGTCTTCCTCTCCATGCACAA-3´; GAPDH Forward: 5´- CTCACCGGATGCACC AATGTT -3´ Reverse: 5´-CGCGTTGCTCACAATGTTCAT -3´. Relative mRNA expression was calculated using the 2-ΔΔCT method, and GAPDH was used as an internal control (19 (link)).
6
Quantitative Analysis of RB mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol reagent (Invitrogen, California, USA). RB expression was measured in triplicate using SYBR Green qPCR Mix (Toyobo, Shanghai, China) according to the manufacturer’s instructions. Primer sequences were as follows: RB Forward: 5′-CTCTCGTCAGGCTTGAGTTTG-3′, RB Reverse: 5′-GACATCTCATCTAGGTCAACTGC-3′; GAPDH Forward: 5′-GGAGCGAGATCCCTCCAAAAT-3′, and GAPDH Reverse: 5′-GGCTGTTGTCATACTTCTCATGG-3′. The comparative Ct method was used to calculate the relative mRNA expression, and GAPDH was used as an internal control.
7
Quantifying mRNA Expression by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA of each sample was synthesized by a RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) from 3 μg of total RNA. The relative mRNA expression was quantified by RT-PCR using SYBR green qPCR Mix (TOYOBO, Japan). RT-PCR was performed on an ABI PRISM 7500 device (Applied Biosystems, USA). The primers used are listed in Table 1 . Each experiment was performed in triplicate. The relative gene expression was normalized by β-actin and calculated using ABI PRISM 7500 v. 2.0.6 software (Applied Biosystems, USA) with the 2−ΔΔCt method.
8
Quantification of Mitochondrial DNA Content
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mitochondrial DNA (mtDNA) content was measured according to the method described by Venegas et al. (46 (link)) with minor modifications. The mtDNA content was defined as the relative ratio between mitochondrial gene (tRNALeu(UUR)) copy number and simultaneously measured copy number of a nuclear gene (β-2-microglobulin, β2M) using qPCR analysis. The qPCR analysis was conducted using a Bio-Rad CFX384 Real-Time system with the SYBR Green qPCR Mix (TOYOBO). Briefly, total hMSC DNAs were purified using Genomic DNA Buffer Set/Genomic-tip 20/G Kit (QIAGEN). 0.5 ng genomic DNAs were used to perform qPCR assays, which generated a datasheet with the CT value for each qPCR. Relative mtDNA content was measured by the difference in ΔCT between the tRNALeu(UUR) and β2M genes, which was calculated as (β2M average CT) – (tRNALeu(UUR) average CT) = ΔCT, 2 × 2(ΔCT) = mtDNA content. qPCR primers used to calculate mtDNA content are listed in Supplementary Table S1 .
9
Quantifying mRNA Expression Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was used to detect the mRNA expression level. Total RNA was extracted from the above cells using TRIzol Reagent (Invitrogen Life Technologies). Subsequently, a First Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania) was used to synthesize cDNA from total RNA using random primers. U6 and GAPDH were used as housekeeping controls. The forward and reverse primer sequences were as follows: MIR22HG, 5′-CAGGAGCCTGTTCCTCTCAC-3′ and 5′-GCCCAAAACGTATCATCCAC-3′; GAPDH, 5′-GGAGCGAGATCCCTCCAAAAT-3′ and 5′-GGCTGTTGTCATACTTCTCATGG-3′; miR-22-5p, 5′-ACACTCCAGCTGGGAGTTCTTCAGTGGCAA-3′ and 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTAAAGCTT-3′; U6, 5′-CTCGCTTCGGCAGCACA-3′ and 5′-AACGCTTCACGAATTTGCGT-3′.
Real-time PCR was performed with a 7300 Fast Real-time PCR system (Applied Biosystems, NY, USA) using a SYBR Green qPCR Mix (TOYOBO). Relative quantification was calculated according to the Δ Δ CT method.
Real-time PCR was performed with a 7300 Fast Real-time PCR system (Applied Biosystems, NY, USA) using a SYBR Green qPCR Mix (TOYOBO). Relative quantification was calculated according to the Δ Δ CT method.
10
Quantitative RT-PCR Analysis of Cell Cycle Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared according to the manufacturer’s instructions. cDNA was synthesized by the SuperScript III First-Strand Synthesis System for reverse transcription PCR (Invitrogen, USA). qRT-PCR was performed using SYBR Green qPCR mix (Toyobo, Japan). All of the PCR primers used in this study are listed in Table 1 . The qRT-PCR assays and data collection were performed on a 7500 real-time PCR system (Applied Biosystems, USA). Data were analyzed by using 2-△△CT values.
The primers used in the PCR reaction and annealing
| Gene name | Sequence (5’to3’) | Direction |
|---|---|---|
| CDKN1A | AGCGACCTTCCTCATCCACC | Forward |
| CDKN1A | AAGACAACTACTCCCAGCCCCATA | Reverse |
| CCNE2 | ATCTCCTGGCTAAATCTCTTTCTCC | Forward |
| CCNE2 | ACTGGAACTCTAATGAATCAATGGC | Reverse |
| CCNA2 | TTTAGCACTCTACACAGTCACGGGA | Forward |
| CCNA2 | GGTGAAGGTCCATGAGACAAGGC | Reverse |
| CDK6 | AGAGCAAGATAATAAAGGAGATGGG | Forward |
| CDK6 | CATGTGAGACTTTGAGTAGACCTGA | Reverse |
| MCM6 | GCTGTCGCACTGTAATCCTCC | Forward |
| MCM6 | ATTGATCGTGTCTATTCCCTCG | Reverse |
| BBC3 | TCTCCTCTCGGTGCTCCTTCACT | Forward |
| BBC3 | ACGTTTGGCTCATTTGCTCTTCA | Reverse |
| GADD45A | CTCAAGCAGTTACTCCCTACAC | Forward |
| GADD45A | CTTCTTCATTTTCACCTCTTTCCA | Reverse |
| CDK1 | TAGTCTGGTCTTTCTTTGGCTG | Forward |
| CDK1 | GTTCAAAACTGGAATAAAACACCTA | Reverse |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!