Antisense oligonucleotide (ASO) against LLNLR-299G3.1 was synthesized by RiboBio (Guangzhou, China). To determine the in vitro interference efficiency, ASO was transfected into TE1 cells using the Lipofectamine 3000 kit (Life Technologies, Shanghai, China) and the expression level of LLNLR-299G3.1 was analyzed by qRT-PCR assay. For the in vitro ASO functional assays, cells were seeded in 96-well plates and transfected with 100 nM of the ASO using the Lipofectamine 3000 kit following the manufacturer’s instruction. At 48 h post transfection, cells were harvested for further analyses.
Antisense oligonucleotide aso
Manufactured by RiboBio
Sourced in China
Antisense oligonucleotide (ASO) is a synthetic, single-stranded nucleic acid molecule designed to bind to and modulate the expression of specific target RNA sequences. It functions by inhibiting the translation or inducing the degradation of the target RNA, thereby regulating the expression of the corresponding gene.
Automatically generated - may contain errors
Lab products found in correlation
Plc5 cir gfp, by Geneseed (3 mentions)
Ribofect cp transfection solution, by RiboBio (3 mentions)
Lipofectamine 3000 kit, by Thermo Fisher Scientific (1 mentions)
Mirna inhibitor, by GenePharma (1 mentions)
Mirna mimic, by GenePharma (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Plvx shrna2 puro vector, by Addgene (1 mentions)
Pcdna3.1 vector, by Promega (1 mentions)
Transfection kit, by RiboBio (1 mentions)
Sirna, by GenePharma (1 mentions)
Sirna, by RiboBio (1 mentions)
9 protocols using antisense oligonucleotide aso
1
Antisense Oligonucleotide Targeting LLNLR-299G3.1
2
Transfection of miRNA Mimics and Inhibitors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both miRNA mimics (50 nM) and miRNA inhibitors (200 nM) were obtained from GenePharma and used for transfection. RNA oligos were transfected by using Lipofectamine RNAiMAX (cat: 13778075, Invitrogen, CA, USA).
Antisense oligonucleotide (ASO) was purchased from Ribobio (Guangzhou, China). Note that 1X riboFECT™ CP Buffer (v2), ASO storage solution and riboFECT™ CP Reagent (v4) were used for ASO transfection.
Antisense oligonucleotide (ASO) was purchased from Ribobio (Guangzhou, China). Note that 1X riboFECT™ CP Buffer (v2), ASO storage solution and riboFECT™ CP Reagent (v4) were used for ASO transfection.
3
Constructing Versatile Gene Expression Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Flag fusion protein construction, thirteen ORFs of ZFP36L2-AS were amplified and subcloned into HindIII and XhoI restriction sites in the pcDNA3.1-3xFlag-C vector.
For overexpression vectors construction, the full-length sequence and 816-1785 nt of ZFP36L2-AS and PC coding sequence (NCBI Reference Sequence: NM_204346.1) were amplified and cloned into the pcDNA-3.1 vector (Promega, Madison, WI, USA) by using the NheI and HindIII restriction sites.
For viral vectors constructed, the full-length sequence of ZFP36L2-AS was amplified, and then cloned into the adenoviral vector (pDC316-mCMV-ZsGreen; Addgene, Cambridge, MA, USA) between NheI and HindIII sites. Short hairpin RNA (shRNA) against ZFP36L2-AS was designed by Shanghai Hanbio Biotechnology Co., Ltd, and then subcloned into the pLVX-shRNA2-Puro vector (Addgene, Cambridge, MA, USA) by using the BamHI and EcoRI restriction sites.
The small interfering RNAs (siRNA) and antisense oligonucleotide (ASO) that were used for the specific knockdown of ZFP36L2-AS were designed and synthesized by Guangzhou RiboBio (Guangzhou, China). The siRNA against ACACA (NCBI Reference Sequence: NM_205505.1) and PC were also designed and synthesized.
The primers and oligonucleotide sequences used in this study are shown in Supplementary Tables4 and 5 .
For overexpression vectors construction, the full-length sequence and 816-1785 nt of ZFP36L2-AS and PC coding sequence (NCBI Reference Sequence: NM_204346.1) were amplified and cloned into the pcDNA-3.1 vector (Promega, Madison, WI, USA) by using the NheI and HindIII restriction sites.
For viral vectors constructed, the full-length sequence of ZFP36L2-AS was amplified, and then cloned into the adenoviral vector (pDC316-mCMV-ZsGreen; Addgene, Cambridge, MA, USA) between NheI and HindIII sites. Short hairpin RNA (shRNA) against ZFP36L2-AS was designed by Shanghai Hanbio Biotechnology Co., Ltd, and then subcloned into the pLVX-shRNA2-Puro vector (Addgene, Cambridge, MA, USA) by using the BamHI and EcoRI restriction sites.
The small interfering RNAs (siRNA) and antisense oligonucleotide (ASO) that were used for the specific knockdown of ZFP36L2-AS were designed and synthesized by Guangzhou RiboBio (Guangzhou, China). The siRNA against ACACA (NCBI Reference Sequence: NM_205505.1) and PC were also designed and synthesized.
The primers and oligonucleotide sequences used in this study are shown in Supplementary Tables
4
Overexpression and Knockdown of circ-LRIG3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To overexpress circ-LRIG3, pLC5-ciR-GFP (#GS0108) vector containing one paired reverse complementary sequence (RCS) provided by Geneseed (Guangzhou, China) was used, in which the full-length of circ-LRIG3 (chr12: 59277301–59,308,117) was inserted into pLC5-ciR vector between EcoRI and BamHI restriction sites, followed by packaging into the lentivirus and infection into HepG2 cells. The stable circ-LRIG3-overexpressing cells were selected by 0.8 μg/mL puromycin. To knock down circ-LRIG3, two antisense oligonucleotide (ASO) against circ-LRIG3 junction site were designed and synthesized by RiboBio (Guangzhou, China). Then, the ASO was transfected into SMMC-7721 cells using riboFECT™ CP transfection solution (RiboBio) based on manufacturer’s protocol.
5
Knockdown and Overexpression of DDX11-AS1 and HNRNPC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-sense oligonucleotide (ASO) that specifically target DDX11-AS1 knockdown and siRNA that specifically targets HNRNPC knockdown were purchased from RiboBio (Guangzhou, China). According to the instructions, ASO and siRNA transfection were also performed using the transfection kit from RiboBio (Guangzhou, China). The ASO targeting sequence is as follows: GGAGAATGAATTCATGCTAA; si-HNRNPC-1: CTCGAAACGTCAGCGTGTA; si-HNRNPC-2: GCCTTCGTTCAGTATGTTA; si-HNRNPC-3: GTGAAGAAAGATGAGACTA. ASO and siRNA were transfected at 50 nM. The HNRNPC knockdown lentivirus was purchased from Genepharma (Shanghai, China), and its sequence was GCGCTTGTCTAAGATCAAATT.
To construct the cell model of DDX11-AS1 overexpression, DDX11-AS1 overexpressed lentivirus was purchased from GeneChem (Shanghai, China). The DDX11-AS1 lentiviral vector was GV502. According to the instructions, 48 h after the virus concentration gradient infected the cells, the infection efficiency was observed with a fluorescence microscope. When a multiplicity of infection (MOI) was 5 with 5 ug/mL Polybrene, the efficiency of infection can reach 80%.
To construct the cell model of DDX11-AS1 overexpression, DDX11-AS1 overexpressed lentivirus was purchased from GeneChem (Shanghai, China). The DDX11-AS1 lentiviral vector was GV502. According to the instructions, 48 h after the virus concentration gradient infected the cells, the infection efficiency was observed with a fluorescence microscope. When a multiplicity of infection (MOI) was 5 with 5 ug/mL Polybrene, the efficiency of infection can reach 80%.
6
Antisense Oligonucleotide Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell transfection was performed according to the manufacturer’s instructions. Antisense oligonucleotide (ASO) were purchased from RiboBio (China). The constructs were verified by sequencing and validated by qRT-PCR. All sequence information is listed in Additional file 2 : Table S7.
7
Targeting SNORD15B Regulation by ASO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antisense oligonucleotide (ASO) targeting SNORD15B and a control ASO were purchased from RiboBio Co., Ltd. (Guangzhou, China). The HEC-1B cells were transfected with the respective constructs (final concentration 25 nM) using Lipofectamine™ 3000 according to the manufacturer's protocol. Plasmids expressing SNORD15B and a vector were obtained from SyngenTech (Beijing, China). Ishikawa cells were transfected with the respective plasmids at 70% confluence using Lipofectamine™ 3000 and P3000 as per the manufacturer's instructions. The sequences of the different constructs are listed in Table 1 and Table 2 .
8
Overexpression and Knockdown of circ-LRIG3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To overexpress circ-LRIG3, pLC5-ciR-GFP (#GS0108) vector containing one paired reverse complementary sequence (RCS) provided by Geneseed (Guangzhou, China) was used, in which the full-length of circ-LRIG3 (chr12: 59277301-59308117) was inserted into pLC5-ciR vector between EcoRI and BamHI restriction sites, followed by packaging into the lentivirus and infection into HepG2 cells. The stable circ-LRIG3-overexpressing cells were selected by 0.8μg/mL puromycin. To knock down circ-LRIG3, two antisense oligonucleotide (ASO) against circ-LRIG3 junction site were designed and synthesized by RiboBio (Guangzhou, China). Then, the ASO was transfected into SMMC-7721 cells using riboFECT™ CP transfection solution (RiboBio) based on manufacturer's protocol.
9
Overexpression and Knockdown of circ-LRIG3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To overexpress circ-LRIG3, pLC5-ciR-GFP (#GS0108) vector containing one paired reverse complementary sequence (RCS) provided by Geneseed (Guangzhou, China) was used, in which the full-length of circ-LRIG3 (chr12: 59277301-59308117) was inserted into pLC5-ciR vector between EcoRI and BamHI restriction sites, followed by packaging into the lentivirus and infection into HepG2 cells. The stable circ-LRIG3-overexpressing cells were selected by 0.8μg/mL puromycin. To knock down circ-LRIG3, two antisense oligonucleotide (ASO) against circ-LRIG3 junction site were designed and synthesized by RiboBio (Guangzhou, China). Then, the ASO was transfected into SMMC-7721 cells using riboFECT™ CP transfection solution (RiboBio) based on manufacturer's protocol.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!