Transcription factor-binding sites in the promoter region of human miR-551b were predicted by TargetScan and PicTar4 biological analysis website: http://www.targetscan.org and http://www.pictar.org . The putative ERBB4-binding site was 5′-AUGGGUCGA-3′, and the mutant ERBB4-binding site was 5′-UGUUUGAU-3′. The ERBB4 luciferase reporter constructs were made by amplifying the human ERBB4 mRNA 3′-UTR sequence by PCR and then cloning it into the XbaI site of the pGL3-promoter construct. The sequences of the human miR-551b promoter region were inserted into pGL3-basic vector (Sangon Biotech, Shanghai, China). The plasmids were then co-transfected with Renilla luciferase expression vector (pRL-TK) into MNK45 cells by Lipofectamine 2000 (Beyotime, Hangzhou, China) according to the manufacturer's instructions. After transfection for 24h, the luciferase activity was measured in samples by Dual-Luciferase Assay Kit (Beyotime, Hangzhou, China).
Pgl3 basic vector
Manufactured by Sangon
Sourced in China
The PGL3-basic vector is a general-purpose plasmid vector commonly used in molecular biology research. It provides a basic framework for the cloning and expression of genetic sequences in various cell lines. The vector contains essential elements for DNA manipulation, such as a multiple cloning site, promoter, and selectable marker. This product is suitable for a wide range of applications, including gene expression studies, reporter assays, and recombinant protein production.
Automatically generated - may contain errors
7 protocols using pgl3 basic vector
1
miR-551b Transcriptional Regulation by ERBB4
2
Identifying KLF8 Binding Sites in MDR1 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic sequence of MDR1 was determined using the National Center for Biotechnology Information‘s Genomic blast program; there are two KLF8 binding sites (CACCC box) in the MDR1 promoter. Promoter sequences of MDR1 carrying wild-type or mutated KLF8 binding sequence were cloned into PGL3-Basic vector (Sangon Biotech, Shanghai, China). Specifically, the two binding sites located on the MDR1 promoter sequence were separately or both mutated, and PRL-TK vector served as the control. Six hours post-transfection, cells were exposed to hypoxia or normoxia for 24 h. The luciferase activity was measured and quantified using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA).
3
Lentiviral Vectors for NOTCH3 and ABCG2 Promoter Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The construction of α2δ1 overexpression and shRNA lentiviral vectors, packaging of lentiviruses and infection of cells were the same as described in our previous paper13 (link). For luciferase reporter construction, the presumptive promoters of human NOTCH3 and ABCG2 containing the wild type NFATc2 binding consensus sequences (5′-TTTCC-3′) or the mutant sequences (5′-CAGCC-3′) were synthesized by Sangon Biotech Co. (Shanghai, China) and subcloned into pGL3-basic vector.
4
Identifying miR-125b Regulatory Mechanisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We predicted transcription factor-binding sites in the promoter region of human miR-125b using the PicTar (https://pictar.mdc-berlin.de/ http://www.targetscan.org
5
Cloning and Construction of Chicken MC1R and ZEB1 Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chicken MC1R g.18838624 T > C TT genotype (E1) and CC genotype (E2) were cloned into the pGL3-Basic vector (Sangon, Shanghai, China), and the luciferase expression vectors pGL3-C and pGL3-T were constructed. The ZEB1 CDS region of Taihang chicken was cloned into the pIRES2-EGFP (Sangon, Shanghai, China) vector to construct the ZEB1 overexpression vector pIRES2-EGFP-ZEB1. Vectors were purified with a vector mini kit without endonuclease treatment (Tiangen, Beijing, China).
6
ARRDC3 Promoter Activity Regulation by H. pylori
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Promoter constructs containing the region from –2000 to 0 of the ARRDC3 gene were amplified from human genomic DNA by PCR. The amplified full length or fragments were cloned into the NheI and HindIII sites of the pGL3-basic vector, respectively, by Sangon Biotech. Mutant of –100/0 sequences were synthesized and cloned into the NheI and HindIII sites of the pGL3-basic vector. The mutant sequence was 5′-GGGCAAGGGAGCGAGCGCGGCGCGGCGCGGCGCGGGAGGGGGCGCGCAGGG GCAGCCGCGGCCTGCGCCTGCGCACTGGGGTTGTTTTTC-3′ (deleted SP1 binding site, 5′-AGGGCGGACA-3′). For the luciferase reporter assay, cells were seeded in 24-well plates and were transfected when reaching approximately 80% confluence with the constructed luciferase reporter vector for 4 hours. Lipofectamine 2000 was used to transfect AGS cells according to the manufacturer’s protocols. Luciferase activity was measured to assess promoter activity after WT H. pylori (cells pretreated with or without U0126 or Wortmannin before WT H. pylori infection) or ΔcagA infection (MOI = 100) for 24 hours by the Dual-Luciferase Reporter assay following the manufacturer’s protocol. Luciferase activity was normalized to Renilla luciferase activity.
7
Mef2a Gene Knockdown Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To select the specific shRNA, the full length CDS of Mef2a gene was cloned into psiCHECKTM-Ⅱ vector and the shRNA was cloned into pENTR/CMV-GFP/U6 vector. For luciferase reporter assay, the bovine MyoZ2 proximal promoter (190bp) containing the MFE2 binding site was cloned into pGL3-Basic vector (Promega). The mutant MyoZ2 promoter sequence was chemically synthesized (Sangon Biotech) by mutating -33bp MEF2 site TATATA to GGGGGG and was also cloned into pGL3-Basic vector. pRL-TK vector was used as internal control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!