Expresshyb

Manufactured by Takara Bio

Sourced in United States

ExpressHyb is a rapid and efficient hybridization solution for Northern blot analysis. It is designed to shorten the hybridization time while maintaining high sensitivity and specificity.

Automatically generated - may contain errors

Lab products found in correlation

Hybond, by Cytiva (7 mentions) Trizol, by Thermo Fisher Scientific (6 mentions) Hybond n nylon filter, by Cytiva (3 mentions) Dig high prime dna labeling and detection starter kit 2, by Roche (1 mentions) Hybond n, by GE Healthcare (1 mentions) Tbe urea gel, by Bio-Rad (1 mentions) Hybond n membrane, by Cytiva (1 mentions) Formaldehyde, by Thermo Fisher Scientific (1 mentions) Formaldehyde, by Merck Group (1 mentions) Formamide, by Merck Group (1 mentions) Rediprime 2, by Cytiva (1 mentions) Nytran, by Cytiva (1 mentions) Typhoon trio variable mode imager, by GE Healthcare (1 mentions) Fla 5100 phosphoimager, by Fujifilm (1 mentions) α 32p datp, by PerkinElmer (1 mentions) Pcr topo 2, by Thermo Fisher Scientific (1 mentions) Zeta probe membrane, by Bio-Rad (1 mentions) Typhoon 9400, by GE Healthcare (1 mentions) Biotin 16 dutp, by Roche (1 mentions) Hindiii, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

ExpressHyb hybridization solution (27 citations) ExpressHyb solution (16 citations) ExpressHyb hybridization buffer (9 citations) ExpressHyb buffer (2 citations)

16 protocols using expresshyb

Southern Blotting Protocol for DNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The gel was immersed for 15 min at room temperature in 0.25M HCl, before rinsing and soaking in denaturing solution (1.5 M NaCl, 0.5 M NaOH) for 30 min at room temperature. Southern blotting was performed essentially as described (25 ), transferring DNA overnight to Hybond N+ (GE Healthcare Bio-Sciences, Pittsburgh, PA, USA). The orientation of the blot and well location were marked with a soft pencil before rinsing in 2× saline-sodium citrate buffer (SSC) (300 mM NaCl, 30 mM sodium citrate, pH7.0) followed by baking at 120°C for 30 min.
Hybridization was performed at 60°C overnight in ExpressHyb (Clontech Laboratories Inc., Mountain View, CA, USA). The blot was prehybridized for 30 min. The probe (25 ng/ml of hybridization buffer) was denatured at 95°C for 8 min, quenched on ice for 2 min before adding to the prehybridization mix and incubating overnight in a rotating oven. The blot was washed at 60°C for 8 min twice with wash one (2× SSC, 0.1% sodium dodecyl sulphate (SDS)) and twice with wash two (0.2× SSC, 0.1% SDS). Digoxigenin-dUTP probes were detected using the DIG High Prime DNA Labeling and Detection Starter Kit II according to the manufacturers instructions (Roche Applied Science, Indianapolis, IN, USA).

Darrow E.M, & Chadwick B.P. (2014). A novel tRNA variable number tandem repeat at human chromosome 1q23.3 is implicated as a boundary element based on conservation of a CTCF motif in mouse. Nucleic Acids Research, 42(10), 6421-6435.

+ Open protocol

+ Expand

Quantitative Northern Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

293T cells were plated at 5.25 × 10⁶ cells in 10-cm dishes and transfected with 20 µg of a Cas9/sgRNA expression plasmid using polyethylenimine. Cells were harvested 72-h post-transfection in TRIzol (Life Technologies). Total RNA was isolated and fractionated on a 10% TBE-Urea Gel (Bio-Rad) and then transferred to HyBond-N membrane (Amersham) and UV crosslinked (Stratalinker, Stratagene). Membranes were prehybridized in ExpressHyb (Clontech) and then incubated at 37°C with a ³²P-end labeled oligonucleotide. Membranes were washed with 2X SSC/0.1% SDS at 37°C and subjected to autoradiography.

Mefferd A.L., Kornepati A.V., Bogerd H.P., Kennedy E.M, & Cullen B.R. (2015). Expression of CRISPR/Cas single guide RNAs using small tRNA promoters. RNA, 21(9), 1683-1689.

+ Open protocol

+ Expand

miRNA Expression Analysis by Northern Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols

miRNA expression was assessed by Northern blot analysis as previously described^{63 (link)}. Briefly, total RNA (5 μg) was separated on a 15% acrylamide TBE 8 M urea gel and blotted onto a Hybond N+ nylon filter (Amersham Biosciences). DNA oligonucleotides complementary to mature miR-148a-3p (5′–ACAAAGTTCTGTAGTGCACTGA–3′) were end-labeled with [a-³²P] ATP and T₄ polynucleotide kinase (New England Biolabs) to generate high-specific activity probes. Hybridization was carried out according to the ExpressHyb (Clontech) protocol. Following overnight membrane hybridization with specific radiolabeled probes, membranes were washed once for 30 min at 42 °C in 4x SSC/0.5% SDS and subjected to autoradiography. Blots were reprobed for 5s rRNA (5′–CAGGCCCGACCCTGCTTAGCTTCCGAGAGATCAGACGAGAT–3′) to control for equal loading.

Goedeke L., Rotllan N., Canfrán-Duque A., Aranda J.F., Ramírez C.M., Araldi E., Lin C.S., Anderson N.N., Wagschal A., de Cabo R., Horton J.D., Lasunción M.A., Näär A.M., Suárez Y, & Fernández-Hernando C. (2015). Identification of miR-148a as a novel regulator of cholesterol metabolism. Nature medicine, 21(11), 1280-1289.

+ Open protocol

+ Expand

Northern Blot Analysis of Viral RNA and Actin mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA and actin mRNA from total cell extracts were detected by northern blotting. Specifically, TRIzol-extracted RNA was resuspended in 2× loading dye (22% formaldehyde (Fisher Bioreagents), 60% Formamide (Sigma), 18% 10× MOPS-EDTA-Sodium Acetate (MESA; Sigma), 0.004% Bromophenol blue), denatured at 65°C for 10 min and separated for 2 h at 100 V in a 1% agarose gel containing 6.7% formaldehyde and 3.7% MESA. RNA was transferred to a nitrocellulose membrane overnight. The following morning RNA was UV-crosslinked to the membranes. Membranes were pre-hybridized in ExpressHyb (Clontech) for 1 h at 55°C, followed by hybridization for 1 h at 65°C with α³²P dATP RadPrime (Invitrogen) labeled probe. Hereafter, membranes were washed three times (30-min/wash) at 55°C in 0.1× saline-sodium citrate (SSC) buffer, 0.1% SDS buffer. Membranes were exposed to a phospho-screen overnight and imaged on a Typhoon 2400 imager. Viral genome and actin mRNA were detected using the following DNA probes targeting different regions within each RNA: ZIKV (nt 10 324–10 808), DENV (nt 10 507–10 526), HCV (nt 1–341) PV (nt 1–753) and actin (nt 685–1171).

McIntyre W., Netzband R., Bonenfant G., Biegel J.M., Miller C., Fuchs G., Henderson E., Arra M., Canki M., Fabris D, & Pager C.T. (2018). Positive-sense RNA viruses reveal the complexity and dynamics of the cellular and viral epitranscriptomes during infection. Nucleic Acids Research, 46(11), 5776-5791.

+ Open protocol

+ Expand

Northern Blot Analysis of miR-27b

Check if the same lab product or an alternative is used in the 5 most similar protocols

miRNA expression was assessed by Northern blot analysis as previously described^{34 (link)}. Briefly, total RNA (5 ug) was separated on a 15% acrylamide TBE 8M urea gel and blotted onto a Hybond N+ nylon filter (Amersham Biosciences). DNA oligonucleotides complementary to mature miR-27b (5’-GCAGAACTTAGCCACTGTGAA-3’) were end-labeled with [a-³²P] ATP and T₄ polynucleotide kinase (New England Biolabs) to generate high-specific activity probes. Hybridization was carried out according to the ExpressHyb (Clontech) protocol. Following overnight membrane hybridization with specific radiolabeled probes, membranes were washed once for 30 min at 42 °C in 4× SSC/0.5% SDS and subjected to autoradiography. Blots were reprobed for 5s rRNA (5′-CAGGCCCGACCCTGCTTAGCTTCCGAGAGATCAGACGAGAT-3′) to control for equal loading.

Goedeke L., Rotllan N., Ramírez C.M., Aranda J.F., Canfrán-Duque A., Araldi E., Fernández-Hernando A., Langhi C., de Cabo R., Baldán Á., Suárez Y, & Fernández-Hernando C. (2015). miR-27b inhibits LDLR and ABCA1 expression but does not influence plasma and hepatic lipid levels in mice. Atherosclerosis, 243(2), 499-509.

+ Open protocol

+ Expand

Polyadenylation Analysis of Mos mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polyadenylation of Mos cRNA was determined as described (Howard et al., 1999 (link); Rasar et al., 2006 (link)). Briefly, 36 hours after oligonucleotide injection, each oocyte was injected with 10 ng of cRNA encoding the terminal 280 nucleotides of the 3′UTR of Mos mRNA and oocytes were allowed to recover for 2 hours. Oocytes were then stimulated with testosterone and permeabilized every 4 hours. RNA was extracted using 1ml Trizol (Invitrogen), and 20μg of total RNA was run on a 2.2% agarose formaldehyde gel in 1x MOPS buffer for ~10 hours at 60V. RNA was transferred to a Nytran SuPerCharge nylon membrane (Schleicher & Schuell) by downward transfer in 20xSSC (Schleicher & Schuell) and UV crosslinked. Membranes were pre-hybridized in ExpressHyb (Clontech) at 68°C for 30 minutes, then probed with [³²P]-dCTP labeled Mos 3′UTR DNA (Rediprime II, Amersham Biosciences) for 1 hour, washed twice in 2x SSC, 0.05% SDS, then twice in 0.1x SSC, 0.1% SDS and subsequently subjected to autoradiography.

Miedlich S.U., Taya M., Young M.R, & Hammes S.R. (2017). Paxillin and embryonic PolyAdenylation Binding Protein (ePABP) engage to regulate androgen-dependent Xenopus laevis oocyte maturation - a model of kinase-dependent regulation of protein expression. Molecular and cellular endocrinology, 448, 87-97.

+ Open protocol

+ Expand

miRNA Expression Analysis by Northern Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Northern Blot Analysis of sgRNA Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols

10 μg of RNA previously extracted with Trizol (Life Technologies) were run on a 15% denaturing polyacrylamide gel and blotted on a nitrocellulose membrane for 1 hour at 100 V at room temperature. The membranes were then hybridized to radiolabeled oligonucleotides complementary to the Alk (5’-TACAGATAGACATGCCAGGAC), Eml4 (5’-TCCTAGTAGACCCCGACAAAC) sgRNAs, or mU6 (5'-GCAGGGGCCATGCTAATCTTCTCTGTATCG) dissolved in ExpressHyb (Clontech) at 42°C overnight. Washes were performed at room temperature in 2X SSC and 0.2 SSC.

Maddalo D., Manchado E., Concepcion C.P., Bonetti C., Vidigal J.A., Han Y.C., Ogrodowski P., Crippa A., Rekhtman N., de Stanchina E., Lowe S.W, & Ventura A. (2014). In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature, 516(7531), 423-427.

+ Open protocol

+ Expand

MicroRNA Detection via Northern Blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using Trizol (Invitrogen), resolved on 10% polyacrylamide-urea gels, and electroblotted onto HyBond N+ membranes. Membranes were hybridized overnight with radiolabeled DNA antisense oligonucleotides to miRNAs in ExpressHyb solution (Clontech). After hybridization, membranes were washed three times with 2× SSC and 0.05% SDS, twice with 0.1× SSC and 0.1% SDS, exposed overnight onto a film. The same blot was hybridized (upon stripping in boiling 0.1% SDS) with up to three distinct oligonucleotide probes (Supplementary Table 1).

Bottini S., Hamouda-Tekaya N., Mategot R., Zaragosi L.E., Audebert S., Pisano S., Grandjean V., Mauduit C., Benahmed M., Barbry P., Repetto E, & Trabucchi M. (2017). Post-transcriptional gene silencing mediated by microRNAs is controlled by nucleoplasmic Sfpq. Nature Communications, 8, 1189.

+ Open protocol

+ Expand

Northern Blot Analysis of RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA samples prepared as described in the previous section were separated by electrophoresis in 1.2% agarose gels containing 2.2 M formaldehyde, 40 mM MOPS (pH 7.0), 10 mM sodium acetate and 1 mM EDTA, partially hydrolyzed in 50 mM NaOH/1.5 M NaCl and transferred overnight to a Hybond N+ membrane in 10 × SSC as described (Brown et al., 2004 ). The membrane was UV-crosslinked (0.12 J/cm²), stained with methylene blue to visualize the 28S and 18S rRNAs, washed in 0.2 × SSC/1% SDS and blocked in ExpressHyb (Clontech; cat# 636831) at 68°C for 1 hour. Hybridization with heat-denatured DNA probe was done in ExpressHyb at 68°C for 2 hours. The membrane was washed twice in 2 × SSC, 0.05% SDS at 68°C and twice in 0.1 × SSC, 0.1% SDS at 50°C, 15 min each wash. The membrane was then dried and radioactive bands were visualized using a Typhoon Trio Variable Mode Imager (GE Healthcare).

Yap K., Mukhina S., Zhang G., Tan J.S., Ong H.S, & Makeyev E.V. (2018). A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival. Molecular Cell, 72(3), 525-540.e13.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!