Tlk1 shrna

Scrambled, TLK1-, and MK5-specific shRNA constructs in lentiviral GFP vector were purchased from Origene (Rockville, MD, USA, TLK1 shRNA cat# TL320623, MK5 shRNA cat# TL320583, scrambled shRNA cat# TR30021). The following primary antibodies were used in this study: rabbit anti-TLK1 (ThermoFisher, Waltham, MA, USA, cat# 720397), mouse anti-PRAK/MK5 (Santa Cruz Biotechnology, Dallas, TX, USA, cat# sc-46667), rabbit anti Phospho- FAK Y397 (ThermoFisher, cat# 44-624G), rabbit anti-Phospho- FAK Y861 (abcam, Cambridge, MA, USA, cat# ab4804), rabbit anti-FAK (Cell signaling technology, Danvers, MA, USA, cat# 3285S), rabbit anti-phospho-paxillin Y118 (Cell signaling technology, cat# 2541S), rabbit anti-paxillin (Santa Cruz Biotechnology, cat# sc-5574), rabbit anti-phospho-HSP27 S82 (ThermoFisher, cat# 44-534G), mouse anti-HSP27 (ThermoFisher, cat# MA3-015), rabbit anti- ERK3 (Cell signaling technology, cat# 4067S), mouse anti-MMP2 (Santa Cruz Biotechnology, cat# sc-13595), mouse anti-MMP9 (Santa Cruz Biotechnology, cat# sc-13520), mouse anti-MMP3/10 (Santa Cruz Biotechnology, cat# sc-374029), mouse anti-Ki-67 (Cell signaling technology, cat# 9449S), and rabbit anti-GAPDH (Cell signaling technology, cat# 2118S).

LNCaP cells were transfected with either wild type mouse full-length NEK1 or NEK1 T141A variant, as previously described [23 (link)]. TLK1 shRNA (ATTACTTCATCTGCTTGGTAGAGGTGGCT) was obtained from origene (Rockville, MD, USA, cat# TR320623). HeLa cells were plated as 10⁵ cells per well in a 6-well plate 24 h before shRNA transfection. Transfection was conducted using 140 nM and 280 nM of TLK1 shRNA by lipofectamine 3000 (Thermo Scientific, Waltham, MA, USA, cat# L3000-015) reagent for 24 h, following the manufacturer’s protocol, and subsequently selected the cells with 1 µg/mL of puromycin for 7 days. Puromycin-selected cells were harvested and knockdown efficiency was determined by WB.