Zebrafish strains with germline mutations in suz12 were generated by the CRISPR-Cas genome editing system (Hwang et al., 2013 (link)), using pCS2-nCas9n to transcribe Cas9 in vitro. The plasmid constructs pDR274 (Addgene #42250 ) and pCS2-nCas9n (Addgene #47929 ) were purchased from Addgene. The following sgRNA sequences were employed to target exon 1 of suz12a or suz12b: suz12a-sgRNA 1, 5′-GGAGGAGCTCACGCATCGTC-3′; suz12a-sgRNA 2, 5′-AGCCGACCACCAACTCTTCC-3′; suz12b-sgRNA 1, 5′-GTGAGCTCACGCCAGAAGAT-3′; suz12b-sgRNA 2, 5′-GGTGCTGTATACCCATCTTC-3′. All oligonucleotides were purchased from Eurofins Genomics (Louisville, KY, USA). To establish suz12-knockout line 1, we used sgRNAs 1 targeting exon 1 for suz12a and suz12b in combination (pair 11×11), and for suz12-knockout line 2 we used sgRNAs 2 targeting exon 1 for suz12a and suz12b in combination (pair 12×12).
Pcs2 ncas9n
Manufactured by Addgene
Sourced in Lithuania
The PCS2-nCas9n is a plasmid that expresses a Cas9 nuclease variant. It can be used for CRISPR-Cas9 gene editing applications.
Automatically generated - may contain errors
Lab products found in correlation
Pdr274, by Addgene (5 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Pbabe hygro htert, by Addgene (2 mentions)
Pspcas9 bb 2a puro, by Addgene (2 mentions)
Las x software, by Leica camera (2 mentions)
Pentr5 ubi loxp egfp loxp, by Addgene (2 mentions)
Dmi8 microscope, by Leica camera (2 mentions)
Mmessage mmachine sp6 kit, by Thermo Fisher Scientific (2 mentions)
T7 rna polymerase, by Thermo Fisher Scientific (2 mentions)
Sp6 rna polymerase, by Thermo Fisher Scientific (2 mentions)
Megashortscript t7 kit, by Thermo Fisher Scientific (2 mentions)
Suz12a sgrna, by Eurofins (1 mentions)
Mlm3636, by Addgene (1 mentions)
Sigmaspin sequencing reaction clean up kit, by Merck Group (1 mentions)
Ambion megascript t7, by Thermo Fisher Scientific (1 mentions)
Mmessage machine sp6 kit, by Thermo Fisher Scientific (1 mentions)
G 5 ppp 5 g rna cap structure analog, by New England Biolabs (1 mentions)
Nanoject injector, by Drummond (1 mentions)
Mmessage mmachine, by Thermo Fisher Scientific (1 mentions)
14 protocols using pcs2 ncas9n
1
CRISPR-Cas9 Zebrafish suz12 Knockout
2
CRISPR/Cas9-mediated Gene Editing in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Capped nuclear-localized Cas9 mRNA (nCas9n) was synthesized by in vitro transcription from a publicly available plasmid vector (pCS2-nCas9n, Addgene #47929) [75 (link)]. Freshly fertilized eggs (1–2 cell stage) from a standard wild type strain (ABTU) were mounted in agar ramps for injection. The injected volume was 1–2 μL of a CRISPR/Cas9 reaction mix (0.3x Danieau buffer with 35–50 ng/μL lcp1 guide RNA, 100–150 μg/nL nCas9n capped mRNA, and 0.025% phenol red). From each clutch, 5–10 embryos were set aside as uninjected controls. 1–2 days after injection, we collected samples of embryos (at least 8 per clutch) to screen for gene editing. After 5–6 days of development, all normal-appearing larvae were returned to the rearing system.
3
CRISPR/Cas9 Zebrafish Mutagenesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 sgRNAs (sgRNA 1: GATCATAGCAGGGGATTCGG AGG, sgRNA2: GGAGTACATGGGTAAAAACA GGG) were designed using the CCTop tool 37 , cloned in the plasmid MLM3636 (Addgene #43860), and synthesized and purified as described elsewhere 38 .
The two sgRNAs were co‐injected at 120–150 ng/μl together with homemade 6.5 μM Cas9 protein‐produced from the pCS2‐nCas9n plasmid (Addgene #47929) in NEB Cas9 buffer (NEB #B0386A) into zebrafish 1‐cell‐stage embryos.
Founder animals were identified at 3 months post‐fertilization (mpf) by fin clip PCR analysis using the primers 5′TCCACTCTGCTTACTTCACAC3′ and 5′TTTGCTTTGTCTGTATGTCCTG3′ and were crossed with AB wild‐type fish to generate F1 progeny. PCR products from the mutant allele of the F1 heterozygous were purified from gel bands (NEB #T1020S) and analyzed by Sanger sequencing. Two lines derived from different injection rounds and progenitors with two different deletions were established: scaf1Δ1 and scaf1Δ2 (deposited in Zfin as cox7a3brn1 and cox7a3brn2, respectively).
Genotyping during line maintenance used the described primers. All experiments were performed comparing scaf1Δ1/Δ1 and scaf1Δ2/Δ2 with their respective wild‐type sibling lines coming from the same founder and AB mating. A maximum of four in‐cross generations were used for the experiments.
The two sgRNAs were co‐injected at 120–150 ng/μl together with homemade 6.5 μM Cas9 protein‐produced from the pCS2‐nCas9n plasmid (Addgene #47929) in NEB Cas9 buffer (NEB #B0386A) into zebrafish 1‐cell‐stage embryos.
Founder animals were identified at 3 months post‐fertilization (mpf) by fin clip PCR analysis using the primers 5′TCCACTCTGCTTACTTCACAC3′ and 5′TTTGCTTTGTCTGTATGTCCTG3′ and were crossed with AB wild‐type fish to generate F1 progeny. PCR products from the mutant allele of the F1 heterozygous were purified from gel bands (NEB #T1020S) and analyzed by Sanger sequencing. Two lines derived from different injection rounds and progenitors with two different deletions were established: scaf1Δ1 and scaf1Δ2 (deposited in Zfin as cox7a3brn1 and cox7a3brn2, respectively).
Genotyping during line maintenance used the described primers. All experiments were performed comparing scaf1Δ1/Δ1 and scaf1Δ2/Δ2 with their respective wild‐type sibling lines coming from the same founder and AB mating. A maximum of four in‐cross generations were used for the experiments.
4
Zebrafish eef1a2 gene CRISPR Targeting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single guide RNA (sgRNA) targeting the zebrafish eef1a2 gene was designed using the online tool CHOPCHOP (http://chopchop.cbu.uib.no/ ) and the oligonucleotides TAGGATAAGTTGAAGGCTGAGA and AAACTCTCAGCCTTCAACTTAT purchased from Integrated DNA Technologies (IDT) with a 5′ phosphate modification to increase ligation efficiency. The sgRNA construct was made by inserting annealed pairs of oligonucleotides into Bsal (New England Biolabs) digested pDR274 (Addgene #42250) backbone. The sgRNA plasmid was used as a template to amplify gRNA sequences, which were then transcribed using the Ambion MAXIscript T7 kit (Thermo Fisher Scientific). Cas9 mRNA was synthesised by transcribing NotI-digested pCS2-nCas9n (Addgene #47929) using the SP6 mMESSAGE mMACHINE kit (Thermo Fisher Scientific) to generate capped mRNA. Purification of synthesised mRNA was performed using SigmaSpin sequencing reaction clean-up kit (Sigma–Aldrich) according to the manufacturer’s instructions.
5
Capped mRNA Synthesis from pCS2-nCas9n
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid pCS2-nCas9n (Addgene #47929) was used as template for synthesis of capped mRNA (see below for a more detailed description). Cas9 nuclease protein was purchased at NEB (catalog number NEBM0386M).
6
CRISPR-Cas9 sgRNA and mRNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Synthesis of the sgRNA specific to each mutation was carried out using the Ambion MEGAscript T7 or SP6 kits (Ambion). Cas9 mRNA was synthesized by linearizing pCS2-nCas9n (Addgene #47929) with the restriction enzyme NotI and subsequently using the linearized plasmid as template for the SP6 mMessage Machine kit (Ambion) to produce capped mRNA. Purification of the in vitro synthesized mRNA was achieved with the RNeasy Mini Kit (Qiagen).
7
CRISPR/Cas9 sgRNA Generation and Embryo Injection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We designed single guide RNAs (sgRNAs) by seeking sequences corresponding to GGN18NGG on the sense or antisense strand of plexin A1 DNA. To generate sgRNAs, we performed PCR with Phusion polymerase without a template50 (link); a unique oligonucleotide encoding the T7 polymerase-binding site and the sgRNA target sequence GGN18N (CRISPRF=GAAATTAATACGACTCACTATA GGN18 GTTTTAGAGCTAGAAATAGC); and a common oligonucleotide encoding the remainder of the sgRNA sequence (sgRNAR=AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC). The DNA templates were used for in vitro transcription by T7 RNA polymerase (Ambion). Four unique sgRNAs were generated using the following CRISPRF oligonucleotides:
sgRNA 1, GAAATTAATACGACTCACTATAGG GAGATGGAGTACGCCACTGTTTTAGAGCTAGAAATAGC;
sgRNA 2, GAAATTAATACGA CTCACTATAGGTAGCAAACGACTGGTTTAGTTTTAGAG CTAGAAATAGC;
sgRNA 3, GAAATTAATACGACTCACTAT AGGACAGAACCAAAGCGAGAGGTTTTA GAGCTAGAAATAGC
sgRNA 4,
GAAATTAATACGACTCACTATAGGACCGATCGACTCCATCACGTTTTAGAGCTAGAAATAGC.
For making Cas9 RNA, pCS2-nCas9n (Addgene 47929)51 (link) was linearized by Not1 and in vitro transcribed by SP6 RNA polymerase (Ambion). RNA of Cas9 (250 ng μl−1) and two sgRNAs (15 ng μl−1 each) in Danieau buffer were injected (3 nl) into one-cell stage embryos. Cas9 only was used as a control.
sgRNA 1, GAAATTAATACGACTCACTATAGG GAGATGGAGTACGCCACTGTTTTAGAGCTAGAAATAGC;
sgRNA 2, GAAATTAATACGA CTCACTATAGGTAGCAAACGACTGGTTTAGTTTTAGAG CTAGAAATAGC;
sgRNA 3, GAAATTAATACGACTCACTAT AGGACAGAACCAAAGCGAGAGGTTTTA GAGCTAGAAATAGC
sgRNA 4,
GAAATTAATACGACTCACTATAGGACCGATCGACTCCATCACGTTTTAGAGCTAGAAATAGC.
For making Cas9 RNA, pCS2-nCas9n (Addgene 47929)51 (link) was linearized by Not1 and in vitro transcribed by SP6 RNA polymerase (Ambion). RNA of Cas9 (250 ng μl−1) and two sgRNAs (15 ng μl−1 each) in Danieau buffer were injected (3 nl) into one-cell stage embryos. Cas9 only was used as a control.
8
CRISPR-Cas9 Enhancer Trap Generation
9
CRISPR Knockdown of vcl-b Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR guide RNA oligonucleotides were designed by targeting exon 1 of vclb using the ZiFit design website (http://zifit.partners.org/ZiFiT/ ). Oligonucleotides 5’- TAGGCCCAGCAGATCTCCCATC-3’ and 5’- AAACGATGGGAGATCTGCTGGG-3’ were annealed and cloned into pDR274 (Addgene, #42250). The construct was linearized using DraI (NEB) and guide RNA was transcribed using the T7 MEGAshortscript kit (Ambion). Cas9 mRNA was generated from NotI linearized pCS2-nCas9n (Addgene, #47929) using the mMessage mMachine SP6 kit (Ambion), and purified using the RNeasy mini kit (Qiagen).
10
CRISPR-Cas9 sgRNA Generation for foxm1 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nine sgRNA spacer sequences targeting foxm1 coding sequence were selected on Benchling (2018) [43 ] based on metrics from Doench and colleagues [44 (link)] and Hsu and colleagues [45 (link)]. Pairs of oligonucleotides where ordered (Sigma-Aldrich, Darmstadt, Germany) and annealed, followed by cloning in the BsaI-digested vector pDR274 (Addgene #42250), as described [46 (link)]. sgRNAs were transcribed using the T7 RNA polymerase (Thermo Scientific, Vilnius, Lithuania) and the HindIII-digested sgRNA expression vector as template. The Cas9 mRNA was transcribed using the SP6 RNA polymerase (Thermo Scientific, Vilnius, Lithuania) and the NotI-digested pCS2-nCas9n (Addgene #47929) as a template, and G(5′)ppp(5′)G RNA Cap Structure Analog (New England Biolabs, Ipswich, MA, USA). The transcribed RNAs were purified using a Sephadex column, followed by the phenol-chloroform extraction [47 (link)], prior to injection. sgRNA sequences can be found in the Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!