U6 chimeric bb cbh hspcas9

Huh-1 (JCRB0199) and HEK293T (ATCC CRL-3216) cells were grown in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS), 5 U/ml penicillin, and 50 μg/ml streptomycin. For overexpression experiments, Huh-1 and HEK293T cells were transfected with Lipofectamine 3000 (Thermo Fisher Scientific) and polyethyleneimine 25 kD linear (PEI, #23966, Polysciences), respectively. To generate p62-knockout HEK293T cells, p62 guide RNA (CACCGTGAAGGCCTACCTTC) designed using the CRISPR Design tool (http://crispr.mit.edu/) was subcloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (#42230, Addgene), a human codon-optimized SpCas9 and chimeric guide RNA expression plasmid. The HEK293T cells were transfected with vector pX330 and cultured for 2 days. Thereafter, the cells were sorted and expanded. Loss of p62 was confirmed by immunoblot analysis with anti-p62 antibody. All cells were authenticated by STR profile and tested for mycoplasma contamination.

Ppp2r2a knockout mice were generated at the Australian Phenomics Network (Monash University, Melbourne, Australia), using the CRISPR/Cas9 technology. The CRISPR Design site http://crispr.mit.edu/ was used to identify guide RNA target sites flanking exon ENSMUSE00000482200 (exon 4) of the Ppp2r2a gene. The following guide RNAs were used: – 5′ TACGATAAAGCAGCCTAGTT 3′ for the 5′ end of exon 4, and – 5′ TTTGCTTTCAGGTACTACAT 3′ for the 3′ end of exon 4. Complementary oligonucleotides corresponding to the RNA guide target sites were annealed and cloned into BbsI (NEB) digested plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230). Single guide RNAs (sgRNA) were generated using the HiScribe^TM T7 Quick High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions. The sgRNAs were purified using the RNeasy Mini Kit (Qiagen). Cas9 mRNA (30 ng/mL, Sigma) and the sgRNAs (15 ng/mL) were microinjected into the cytoplasm of C57BL/6J zygotes at the pronuclei stage. Injected zygotes were transferred into the uterus of pseudopregnant F1 (C57BL/6 × CBA) females. Forward (5′ GTGTTCCAGCCAGCTGTTTCT 3′) and reverse (5′ GACACTGCTGCCTATGTCTGCT 3′) genotyping PCR primers flanking the targeted region and amplifying a product of 819 bp from the wild-type DNA were used to characterize gene editing events in the resulting mice.