PC9 and HCC827 cells were washed twice with ice-cold PBS and lysed with RIPA buffer (50 mM Tris, 1 mM EDTA, 150 mM NaCl, 1% Sodium deoxycholate, 0.1% SDS) (P0013B; Beyotime; China). The lysed samples were centrifuged for 15 min at a maximum speed (14000 rpm). The whole cell extracts were quantified by BCA Protein Assay kit (P0012S; Beyotime; China) and boiled for 5 min. Denatured proteins was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to PVDF membranes (Millipore). Subsequently, PVDF membranes were blocked with 5% milk-powder in PBST (1×PBS containing 0.1% Tween-20) for 1 ~ 2 h and then incubated overnight with primary antibodies, including CARM1 (Abcam; ab245467), CCNE2 (Abcam; ab32103), H3R17me2a (Abcam; ab8284), H3R26me2a (Abcam; ab194679), Histone H3 (Abcam; ab1791) and GAPDH (Abcam; ab181602). After washing with PBST, the PVDF membranes were incubated with horseradish peroxidase-conjugated secondary antibody (Sigma). Protein expression was visualized by enhanced chemiluminescence detection kit (Thermo Scientific Pierce). GAPDH was used as a loading control.
Ab8284
Manufactured by Abcam
Sourced in United States
Ab8284 is a primary antibody produced in rabbit that recognizes the human CD31 (PECAM-1) protein. CD31 is a transmembrane glycoprotein involved in cell-cell adhesion.
Automatically generated - may contain errors
Lab products found in correlation
Ab245467, by Abcam (2 mentions)
Ab32103, by Abcam (1 mentions)
Horseradish peroxidase conjugated secondary antibody, by Merck Group (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Bca protein assay kit, by Beyotime (1 mentions)
Pvdf membrane, by Abcam (1 mentions)
Ab2850, by Abcam (1 mentions)
Ab13537, by Abcam (1 mentions)
Ab2851, by Abcam (1 mentions)
Ab80261, by Abcam (1 mentions)
Ab5103, by Abcam (1 mentions)
Cl amidine, by Cayman Chemical (1 mentions)
Anti gapdh sc 47724, by Santa Cruz Biotechnology (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Pgl3 basic vector, by Promega (1 mentions)
H3r17me2a, by Merck Group (1 mentions)
Ab1791, by Abcam (1 mentions)
I5006 10mg, by Merck Group (1 mentions)
Mab3408, by Merck Group (1 mentions)
Anti nanog, by Abcam (1 mentions)
6 protocols using ab8284
1
Western Blot Analysis of CARM1, CCNE2, and Histone Modifications
2
CARM1 and Histone Methylation Regulation of CCNE2 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In brief, PC9 and HCC827 cells were collected and cross-linked with formaldehyde at room temperature for 10 min. Then, the chromatin is randomly sheared by sonication to generate chromatin fragments, generally ranging from 200 to 500 base-pairs. After sonication, 2 μg of CARM1 (Abcam; ab245467), H3R17me2a (Abcam; ab8284), H3R26me2a (Abcam; ab194679) or control rabbit IgG (Beyotime; A7016) were incubated overnight with chromatin fragments and protein G agarose. After washing with low salt, high salt, LiCl and TE buffers, the immune complexes were treated with elution buffer and eluted from the protein G agarose beads. DNA was extracted with phenol/chloroform and followed by ethanol precipitation. Purified DNA was dissolved in TE buffer or ddH2O and analyzed by real-time PCR with specific primers for CCNE2 promoter. The primer sequences were as follows: (F) GAAAGACCTGGGTTCCCTGA, ® CTGCAACTCCTGGATTTCGG.
3
Epigenetic Regulation in Cell Differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ATRA (All-trans-retinoic acid), 5-aza-2-deoxycytidine (DAC), trichostatin A (TSA) and anti-PADI4 (P4874) were purchased from Sigma (St. Louis, MO). Cl-amidine was from Cayman Chemical Company in USA. pGL3-basic vector and Dual Luciferase Reporter Assay System were from Promega Corp. Antibody specific to SOX4 (ab80261), H3R17Me (Ab8284), H3Cit (Ab5103), DNMT1 (ab13537), DNMT3a (ab2850), DNMT3b (ab2851), Tubulin (ab126165), Lambin B (ab16048) and horseradish peroxidase coupled secondary antibodies were obtained from Abcam (Cambridge, MA, USA). Anti-GAPDH (sc-47724) and anti-PU.1 antibody (sc-365208) were from Santa Cruz Biotechnology Anti-human CD11b antibody (11–0113) was from eBiosciences in San Diego of USA.
4
CARM1 Methylation Motif Antibody Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CARM1 substrate motif antibodies were raised against an antigen mixture of six different CARM1 methylated motifs (Fig 1A ), to specifically recognize endogenous proteins when asymmetrically dimethylated by CARM1. The meMED12 antibodies were raised against the peptide sequence TSVYR*QQQP of human MED12 protein (NP_005111). This work was performed in collaboration with Cell Signaling Technology (CST). mePABP1 antibody was raised against the peptide sequence CGAIR*PAAPR*PPFS of human PABP1 protein (NP_002559) (Cheng & Bedford, 2011 (link)). R* denotes asymmetrically dimethylated arginine residue. The MED4, MED30, and CDK8 antibodies were a gift from Thomas Boyer (University of Texas Health Science Center at San Antonio). The CARM1 antibody, used for ChIP-seq, was a gift from Stéphane Richard (McGill University). The following antibodies were obtained commercially: H3R17me2a (07-214; Millipore and ab8284; Abcam), MED12 (A300-774A; Bethyl), SRC-1 (2191; CST), SRC-3/AIB1 (611105; BD Transduction), CARM1 (A300-420A; Bethyl), PRMT1 (A300-722A; Bethyl), PRMT6 (A300-929A; Bethyl), CDK8 (SC-1521; Santa Cruz), and FLAG (F7425 [rabbit IgG] and F3165 [mouse IgG]; Sigma-Aldrich).
5
Western Blot, IF, and IP Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following antibodies were used in western blot, immunofluorescence staining, and immunoprecipitation: Rabbit affinity‐purified anti‐murine PRMT4 was produced using His‐tagged recombinant protein corresponding to aa 433‐608 of murine PRMT4 7 , anti‐human PRMT4 (09‐818, Merck Millipore, epitope aa 595‐608), anti‐β‐tubulin (MAB3408, Merck Millipore), anti‐H3R17me2a (ab8284, Abcam), anti‐H3 (ab1791, Abcam), anti‐ADMA (13522, Cell Signaling), anti‐Flag (F 3165, Sigma Aldrich), and anti‐rabbit IgG (I5006‐10MG, Sigma Aldrich).
6
Quantitative Protein Analysis in Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot analyses were performed according to Stixová et al. (2012) . For analyses, we used the following primary antibodies: anti-OCT4 (#sc5279, Santa Cruz Biotechnology); anti-NANOG (mouse specific #ab80892, Abcam); anti-NANOG (human specific #sc293121, Santa Cruz Biotechnology); anti-Endo-A (kindly provided by Dr. Jiří Pacherník, Masaryk University, Brno, Czech Republic); anti-fibrillarin (#ab5821, Abcam); anti-UBF1/2 (#ab75781, Abcam); anti-α-tubulin (#LF-PA0146, Fisher-Scientific); antihistone H3 asymmetric R17 dimethylation (me2) (#ab8284, Abcam). Total protein levels were measured by µQuant spectrophotometer (BioTek).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!