Full-length of YY1 (NG_046908.1) and AKT (NG_046997.1) coding sequence were amplified from cDNA of CAL27 with a high-fidelity DNA polymerase KOD FX (TOYOBO, Osaka, Japan) by using standard PCR techniques. The PCR products were cloned into pZeroBack/blunt vectors (Tiangen, Beijing, China). YY1 was re-cloned into pEGFP-C1 plasmids at KpnI and XmaI sites and pLVX-AcGFP-N1 vectors (Clontech, Mountain View, CA, USA) at EcoRI and SmaI sites, respectively. AKT was re-cloned into pLVX-AcGFP-N1 vectors (Clontech, Mountain View, CA, USA) at EcoRI and BamHI sites, and according to reported early67 (link), we then constructed constitutively active AKT (CA-AKT) by mutation of both serine at 473 site and threonine at 308 site into aspartic acid with following sequence, S473D: TCCCCCAGTTCGACTACTCGGCCAG (sense); CTGGCCGAGTAGTCGAACTGGGGGA (antisense); T308D: GCCACCATGAAGGACTTTTGCGGCACA (sense); TGTGCCGCAAAAGTCCTTCATGGTGGC (antisense). Italic refer to mutation nucleotides. All the constructs were confirmed by DNA sequencing. ALL plasmids were transfected by Mirus (Mirus Bio, WI, USA). HA-ubiquitin plasmid was kindly provided by Professor Shiaw-Yih Lin at department of Systems Biology, University of Texas M. D. Anderson Cancer Center, Houst YY1 5′-UTR on, USA68 (link).
Pzeroback blunt vector
Manufactured by Tiangen Biotech
Sourced in China
The PZeroBack/blunt vector is a plasmid DNA vector designed for cloning blunt-ended DNA fragments. It provides a simple and efficient method for inserting PCR products or other DNA fragments with blunt ends into the vector for further manipulation and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Kod fx, by Toyobo (2 mentions)
Lsm 700, by Zeiss (2 mentions)
Plvx acgfp n1 vector, by Takara Bio (1 mentions)
Pegfp c1, by Takara Bio (1 mentions)
Pgl3 basic plasmid, by Promega (1 mentions)
Pgl3 control plasmid, by Promega (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Digoxigenin 11 utp, by Roche (1 mentions)
Fast red, by Roche (1 mentions)
Nbt bcip, by Roche (1 mentions)
High fidelity dna polymerase, by Toyobo (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Escherichia coli dh5α competent cells, by Tiangen Biotech (1 mentions)
Tiangel midi purification kit, by Tiangen Biotech (1 mentions)
Primescript 2 first strand cdna synthesis kit, by Takara Bio (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Lightcycler 480 real time pcr system, by Roche (1 mentions)
11 protocols using pzeroback blunt vector
1
Cloning and Mutating YY1 and AKT Genes
2
Cloning and Sequencing of PPP2CA and YY1 Promoters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence of the human PPP2CA promoter and YY1 promoter were obtained from GenBank. The putative full-length promoter of human PPP2CA (−2000 to +88) and of YY1 (−1500 to +40) was amplified from the genomic DNA of CAL27 cells with a high-fidelity DNA polymerase KOD FX (TOYOBO) using standard PCR techniques. The translational start site was identified as +1. The PCR products were cloned into pZeroback/blunt vectors (Tiangen, Beijing, China) and YY1 promoter re-cloned into pGL3-Basic plasmids (Promega) at KpnI and HindIII sites, whereas PPP2CA promoter re-cloned into pGL3-Basic plasmids (Promega) at KpnI and NheI sites. The constructs were confirmed by DNA sequencing.
3
Cloning YY1 5'-UTR and 3'-UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleotide sequences of YY1 5′-UTR and 3′-UTR were acquired from the GenBank (NM_003403.4). We designated the translation start site of YY1 as +1, therefore, the downstream of the coding sequence (+1246 to +2679) was 3′-UTR, and the upstream of the coding sequence (−480 to −1) as YY1 5′-UTR that was consistent with a previous study32 (link). YY1 3′-UTR and 5′-UTR were amplified by PCR and cloned into pZeroback/blunt vectors (Tiangen, Beijing, China) and re-cloned into pGL3-Control plasmids (Promega) at XbaI sites, respectively. The primers for cloning the 5′-UTR of YY1 were as follows: TCTAGAAGGGCGAACGGGCGAGTGGC (sense); TCTAGACCATGGCTGAGGGCTCCGCCG (antisense). The primers for cloning the 3′-UTR of YY1 were as follows: TCTAGA AAAGAAGAGAGAAGACCCTTCTCGACC (sense); TCTAGA AGAAACATGAAATTAAGCTACTGGCACTCA (antisense). All the constructs were confirmed by DNA sequencing.
4
Soybean GmFULa Gene Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequences of GmFUL family genes and their encoding proteins were obtained from Phytozome (https://phytozome.jgi.doe.gov ). Conserved domains were searched in the NCBI database. The CDS of GmFULa was amplified from the soybean cultivar Zigongdongdou (ZGDD) with the primers listed in Supplementary Table S1. Then, the PCR products were cloned into the pZeroBack/blunt vector (TianGen, Beijing, China). Sanger sequencing was then performed to confirm the sequences and variations (Shanghai Sangon Biological Engineering Technology and Service CO., LTD, Zhengzhou, China).
5
Toe Biopsy DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Toe biopsies were collected for genomic DNA extraction and analysis following the approved procedure protocol. PCR primers were the same as those previously described in T7EI assay. PCR was performed by Q5 High-Fidelity DNA Polymerase (NEB) with the parameters as follows: 98 °C for 30 S; 35 cycles of 98 °C for 10 s, 58 °C for 15 s, 72 °C for 20 s; 72 °C for 2 min. The PCR products were then subcloned into the pZeroBack/Blunt vector (Tiangen Biotech). After transformation, 10 positive colonies were picked for Sanger sequencing.
6
Cloning and Characterization of GmFLC-like Gene in Soybean
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frame (ORF) of GmFLC-like was amplified using specific primers K-FLC-F and K-FLC-R and inserted into the pCAMBIA1301 plasmid by the BamHI and KpnI restriction sites to form the expression vector 35S::GmFLC-like-GFP. Genomic DNA was isolated from leaf samples of soybean using the modified cetyltrimethyl ammonium bromide (CTAB) method [69 (link)]. The promoter sequence of GmFLC-like was amplified using specific primers designed as Pro-GmFLC-F and Pro-GmFLC-R, and genomic DNA of soybean was used as the template. The amplified PCR product was inserted into a pZeroBack/blunt vector (Tiangen Biotech Co., Beijing, China) for sequencing. All primers used are listed in Supplementary Table S1 .
7
Whole-mount in situ hybridization and immunostaining
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-mount in situ hybridization was performed as previously described [65 (link)]. The constructs for goosecoid, chordin, tbxta, dlx3, ctslb, otx2, pax2a and egr2b were reported previously [65 (link), 66 (link)], and otx1, axin2, hoxb1b, cdx4, sp5l, tbx16l and dvl2 constructs were generated by cloning PCR framents in pZeroBack/Blunt Vector (Tiangen). They were labeled using digoxigenin-11-UTP (Roche Diagnostics). Staining of embryos simultaneously hybridized with tbxta, dlx3, and ctslb probes was performed using NBT/BCIP and Fast Red as substrates (Roche Diagnostics), respectively.
For immunostaining, the embryos were fixed in 4% paraformaldehyde at 4°C overnight, and washed with PBST (PBS, 0.1% Triton X-10), they were then incubated in mouse monoclonal anti-ß-catenin antibody (1/250, Sigma-Aldrich, C7207) at 4°C overnight. After several washes in PBST, embryos at high stage were incubated with horseradish peroxidase conjugated secondary antibody (1/500, INTERCHIM), followed by incubation in diaminobenzidine substrate, and embryos at shield stage were incubated with Alexa-488 conjugated secondary antibody (1/1000, INTERCHIM), followed by confocal microscopic imaging (Zeiss, LSM700).
For immunostaining, the embryos were fixed in 4% paraformaldehyde at 4°C overnight, and washed with PBST (PBS, 0.1% Triton X-10), they were then incubated in mouse monoclonal anti-ß-catenin antibody (1/250, Sigma-Aldrich, C7207) at 4°C overnight. After several washes in PBST, embryos at high stage were incubated with horseradish peroxidase conjugated secondary antibody (1/500, INTERCHIM), followed by incubation in diaminobenzidine substrate, and embryos at shield stage were incubated with Alexa-488 conjugated secondary antibody (1/1000, INTERCHIM), followed by confocal microscopic imaging (Zeiss, LSM700).
8
Cloning and Knockdown of GGTase-Iβ
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length of GGTase-Iβ coding sequence was amplified from cDNA of CAL27 cells (human cancer cell line) with a high-fidelity DNA polymerase (TOYOBO, Osaka, Japan) by using standard polymerase chain reaction (PCR) techniques. The amplified gene was cloned into a pZeroBack/blunt vector (Tiangen, Beijing, China) and re-cloned into pEGFP-C1 plasmid at KpnI and XmaI sites. The constructs were confirmed by DNA sequencing. siRNAs for HDAC1, HDAC10, and HDAC11 was custom synthesized as described before [38 (link),55 (link)]. Human GGTase-Iβ siRNA was synthesized in the following sequence: GGTase-Iβ-1 5′-GGCCUCUCAUGCUUAGUUATT-3′; GGTase-Iβ-2 5′-GGAGGAAAGUGGAAUUUGUTT-3′. siRNAs and plasmid were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.
9
Genotyping HMW-GS Genes in Roegneria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from fresh leaves of seedlings using the cetyltrimethylammonium bromide (CTAB) method described by Webb and Knapp [36 (link)]. A pair of degenerate primers, P1: 5′-ATGGCTAAGCGGC/TTA/GGTCCTCTTTG-3′ and P2: 5′-CTATCACTGGCTG/AGCCGACAATGCG-3′ [9 (link)], were used to amplify the ORFs of HMW-GS genes from R. nakaii and R. alashanica using the high-fidelity PrimeSTAR HS DNA Polymerase with GC buffer II (TaKaRa, Dalian, China) to avoid PCR errors. The PCR was as follows: denaturation for 3 min at 98 °C; followed by 30 cycles of 20 s at 98 °C, 30 s at 69 °C, and 3 min at 72 °C; extended finally for 10 min at 72 °C. The amplicons were separated on 2.0% agarose gel, and the anticipated band was excised and purified using a TIANgel Midi Purification Kit (TIANGEN, Beijing, China). The purified DNA fragments were cloned into pZeroBack/Blunt vector (TIANGEN). The recombinant plasmids were transformed into Escherichia coli DH5α competent cells (TIANGEN). Nucleotide sequencing was performed commercially (Beijing Genomics Institute, Beijing, China) and the final sequence for each HMW-GS gene was determined from the sequencing results of several independent clones.
10
Quantification of Viral Gene Expression in DF-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primers (Table 2 ) were synthesized by BoShi Biotechnology Company (Harbin, China). The gene was amplified from the genomic DNA of DF-1 cells by polymerase chain reaction (PCR). The PCR-amplified products were separated in a 2% agarose gel and then purified using a DNA gel extraction kit (Axygen Biotechnology Limited, Hangzhou City, China). The products were then ligated into the pZeroBack/blunt vector (Tiangen Biotech Co., Ltd., Beijing, China), and the sequence was verified. The plasmid DNA was used as the standard to construct the standard curve via SYBR Green real-time PCR. The total cellular RNA of the infected or mock-infected DF-1 cells was extracted using the RNeasy Mini Kit (QIAGEN, China) according to the manufacturer's protocol. Reverse transcription was performed using a PrimeScript II First-Strand cDNA Synthesis Kit (TaKaRa, China) as described in the protocol. The real-time PCR was performed using the Roche LightCycler 480 real-time PCR System.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!