6 mercaptohexan 1 ol

Hydrogen tetrachloroaurate trihydrate (HAuCl₄), trisodium citrate, L-ascorbic acid, 6-mercaptohexan-1-ol (MCH), zinc acetate, magnesium chloride, 3-aminopropyltriethoxysilane (APTES), tris (2-carboxyethyl) phosphine hydrochloride (TCEP) were purchased from Sigma-Aldrich (St. Louis, MO, USA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Sunshine Biotech. Co. Ltd. (Nanjing, China). The ribonucleo-base-contained substrate stands were obtained from Takara Biotechnology Co. Ltd. (Dalian, China). Oligonucleotide strands were obtained from Shanghai Sangon Biological Engineering Technology & Services Co. (Shanghai, China). The UltraPower^TM DNA dye was purchased from BioTeke Co. (Beijing, China). LysoTracker Red was bought from Beyotime Institute of Biotechnology (Nantong, China).
The sequences of oligonucleotides (from 5′ to 3′) utilized to assemble the probe are as follows:
DNAzyme strand: SH-TTTTTCTTCTTCTTCTATGTCTCCGAGCCGGTCGAAATAGCTTAT
Substrate strand: TCAACATCAGTCTGATAAGCTAT (rA) GGACATAGAAGAAGAAG
Inactive substrate strand: TCAACATCAGTCTGATAAGCTAT (A) GGACATAGAAGAAGAAG
AS1411 aptamer: TTTTTGGTGGTGGTGGTTGTGGTGGTGGTGG
The underlined bases of the active substrate strand stand for anti-miR-21 which could hybridize with the intracellular miR-21.

Tetracycline hydrochloride (TET), oxyTetracycline hydrochloride (OTC), doxycycline hydrochloride (DOX), 6-mercaptohexan-1-ol (MCH), sodium perchlorate (NaClO₄), and sodium phosphate (Na₂HPO₄) were purchased from Sigma-Aldrich (Poznań, Poland). Potassium hydroxide, sulphuric acid, ethanol, and methanol were obtained from POCh (Gliwice, Poland). Alumina slurries with particle sizes of 0.3 µm and 0.05 µm were ordered from Buehler (Lake Bluff, IL, USA). The TET binding aptamer modified with ferrocene (Fc) HS-Apt-Fc:
5′–Fc–CCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGT–(CH₂)₃–SH–3′, used as a probe, was synthesized by Biomers (GmbH, Germany). Commercially available UHT cow’s milk with 1.5% fat content was used as a natural matrix.
All electrochemical measurements and steps of aptasensor preparation were performed using a buffer containing 0.1 M NaClO₄ & 2.5 mM Na₂HPO₄, pH 7.0.
All aqueous solutions were prepared with deionized and charcoal-treated water (resistivity of 18.2 MΩ/cm) purified with a Milli-Q reagent-grade water system (Millipore, Bedford, MA). All solutions were deoxygenated by purging with nitrogen (ultra-pure 6.0, Air Products, Warsaw, Poland) for 20 min.

Sodium acetate (NaAc; p.a., POCH, Poland), magnesium acetate (Mg(Ac)₂; p.a., POCH, Poland), potassium persulfate (VWR Chemicals), potassium hydroxide (POCH, Poland), trisodium phosphate (Chempur, Poland), 1× PBS buffer (pH 7.4; Sigma), absolute ethanol (99.8%; POCH, Poland), EDTA (Sigma), tris–EDTA buffer (TE; Sigma), tris(2-carboxyethyl)phosphine hydrochloride (TCEP; Sigma), 2-amino-2-(hydroxymethyl)propane-1,3-diol (Tris; Sigma), 6-mercaptohexan-1-ol (MCH; Sigma) were all of high purity, and were used as received. For all the experiments, we used distilled and deionized water with a conductivity of 0.056 μS cm⁻¹ produced by the Hydrolab system. The following oligonucleotides, purchased from MWG-Operon (Eurofins), were used:
• Capture DNA (5′ → 3′): thiol-C6-GCCTTCACAGGGTCCTTTATGT.
• Complementary target DNA (5′ → 3′): ACATAAAGGACCCTGTGAAGGC.