Total RNA of the Mn9D cells was extracted using a RNAsimple total RNA isolation kit (DP419, Tiangen). Then, the RNA was reverse‐transcribed to cDNA using the Goscript Reverse Transcription kit (A5000, Promega). The qPCR was carried out using SYB Green master mix (A25742, Life Technology) and ABI 7500 real‐time PCR system (Applied Biosystems). The mRNA levels of Alix were normalized to those of GAPDH levels with 2−ΔΔCT method. The primer sequences of Alix and GAPDH are as follows: Alix forward primer: GCCCGTCAACAGTAGTTGAAT; Alix reverse primer: CCCGGAGAAGTACTGGTGTC; GAPDH forward primer: CGGAGTCAACGGATTTGGTCGTAT; GAPDH reverse primer: AGCCTTCTCCATGGTGGTGAAGAC.
Rnasimple total rna isolation kit
Manufactured by Tiangen Biotech
Sourced in China
The RNAsimple Total RNA Isolation Kit is a laboratory equipment designed for the efficient extraction and purification of total RNA from a variety of biological samples. It utilizes a guanidinium thiocyanate-based lysis buffer and a silica-based membrane technology to selectively bind and isolate RNA molecules.
Automatically generated - may contain errors
Lab products found in correlation
Goscript reverse transcription kit, by Promega (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Tb green premix ex taq 2, by Takara Bio (1 mentions)
Cfx connect real time pcr system, by Bio-Rad (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Iq5 real time pcr system, by Bio-Rad (1 mentions)
3 protocols using rnasimple total rna isolation kit
1
Quantifying Alix mRNA Levels in Mn9D Cells
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNAsimple Total RNA Isolation Kit (Tiangen, Beijing, China). Next, 1 μg of total RNA was reverse-transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian, China). RT-qPCR was performed using the CFX Connect Real-Time PCR system (Bio-Rad, Hercules, CA, USA). Each reaction mixture had a final volume of 25 μL, containing 2 μL of cDNA template, 12.5 μL of TB Green Premix Ex Taq II (Takara), and 0.4 μM gene-specific primers. The PCR cycle was as follows: initial incubation at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and at 60 °C for 34 s. We then performed melting curve analysis of amplicons to determine the specificity of PCR. Rice Actin1 or ubiquitin genes were used for data normalization. We used the 2−ΔΔCT method to calculate relative expression levels of target genes. Primers used for RT-qPCR are listed in Table S1 .
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed according to Li et al. (2019) . Total RNA was extracted using an RNAsimple Total RNA Isolation Kit (Tiangen Biotech Co. Ltd., Beijing, China) following the manufacturer's instructions. Chromosomal DNA contamination was removed by incubating the RNA samples with gDNA Eraser (Takara Company, Dalian, China) at 42°C for 3 min, and 2 µg of RNA was reverse-transcribed to complimentary DNA using a PrimeScript RT reagent kit (Takara). The primer sequences used for real-time PCR are listed in Table 1 (Chen et al., 2021) . The reactions were conducted on a Bio-Rad IQ5 Real-time PCR System (Bio-Rad Laboratories Inc., Hercules, CA, USA) using Takara SYBR Premix Ex Taq in a total volume of 20 μL containing: 10 μL of SYBR Premix Ex Taq, 8 μL of sterile deionised water, 1 μL of diluted cDNA, and 1 μL of each primer. Real time cycles were same for all primers: 95°C for 30 s, followed by 40 cycles at 95°C for 5 s, 60°C for 15 s, and finally 72°C for 20 s. Expression levels of genes were calculated using the C T method with the
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!