Mirna qpcr kit

Aliquots containing 100 ng of three exoRNA samples from CCM isolated by different methods were used for RNA library preparation, following the instructions for the NEBNext Multiplex Small RNA library preparation kit (New England Biolabs, Ipswich, MA, USA). The PCR amplified cDNA construct (from 140–160 bp) was purified using a QIAquick PCR Purification kit (Qiagen). The purified cDNA was directly sequenced using an Illumina MiSeq 2000 platform (Illumina, San Diego, CA, USA). The miRNA contained in serum exosomes was analyzed using an All-in-One™ miRNA First-Strand cDNA synthesis kit and miRNA qPCR kit (GeneCopoeia, Rockville, MD, USA).

Total tissue RNA was extracted by a total tissue RNA extraction kit (Beyotime Biotechnology, People’s Republic of China) and reverse-transcribed into cDNA by All-in-One™ miRNA First-Strand cDNA Synthesis Kit (GeneCopoeia Inc., Germantown, MD, USA). The RNA was harvested from frozen specimens that were stored at −80°C following surgical resection. The expression level of MiR-21-5p (reverse primer: 5′- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGT TGAGGATTATGA-3′; forward primer: 5′-ACACTCCA GCTGGGTAGCTTATCAGACTGA-3′) and U6 (reverse primer: 5′-AACGCTTCACGAATTTGCGT-3′; forward primer: 5′-CTCGCTTCGGCAGCACA-3′) were detected by an miRNA-qPCR kit (GeneCopoeia Inc.) and real-time fluorescence quantitative PCR instrument (Agilent Technologies, Santa Clara, CA, USA). The results were presented as 2^−∆∆Ct (∆∆Ct=∆Ct_tumor − ∆Ct_adjacent; ∆Ct=Ct_MiR-21-5p−Ct_U6). The unit of expression of MiR-21-5p in tumor tissues is given in fold change and is compared to adjacent normal tissues.