Shgfp

For knockdown, small interfering RNAs (siRNAs) were purchased from RiboBio and shRNAs were cloned into the pLKO.1 vector. The siRNA or shRNA sequences are listed in Supplementary Table 3. For overexpression, FL and mutant mouse TDP-43 with Flag tags were cloned into pTRIPZ-inducible lentiviral expression vector, which can induce overexpression under 2 μg/ml doxycycline (Sigma, D9891). Sequencing verified all plasmid constructs to exclude mutations. These vectors were co-transfected with psPAX2 and pMD2.G (4:3:1) into 293 T cells to produce lentiviral particles, which were then transfected into HC11 cells. After 72–96 h, the cells were collected for further analysis or experiments. We used sh-GFP (Addgene #30323) and sh-TRC (Addgene #10879) as the shRNA controls and pTRIPZ-Flag-empty vector as the overexpression control. For RNA pull-down assays, fragments of Btn1a1 and Xdh were cloned into pcDNA3.1 under the T7 promoter. To generate the GFP reporter vector (pcDNA/GFP), the GFP fragment was cloned into pcDNA3.1(−) at the BamHI and EcoRI sites. The pcDNA/GFP-Btn1a1-UTR construct was then created by inserting the Btn1a1 3′-UTR sequence (corresponding to NM_013483.3 from 2781 to 3398 nt) into the pcDNA/GFP vector at the EcoRV and SacII sites. All primers used in this study are listed in Supplementary Table 3.

The generation of gene stable silencing cell line was performed as described previously [17 (link)]. Two different single-guide RNAs (sgRNAs) were used to generate CRISPR-Cas9-based Skp2 knockout constructs (sgSkp2#1 forward, 5′-AAGACTTTGTGATTGTCCGC-3′, reverse, 5′-GCGGACAATCACAAAGTCTT-3′; sgSkp2#2 forward, 5′-GCAACGTTGCTACTCAGGTC-3′, reverse, 5′-GACCTGAGTAGCAACGTTGC-3′). The Skp2 stable knockout single clone was generated by transient transfection of sgSkp2 plasmids followed by selection with 1 μg/mL puromycin for three weeks. The shGFP (#110318, Addgene) was used as a shCtrl. Mcl-1 stable knockdown cells were generated using shRNA (AAACCCAGGGCTGCCTTGGAAAAG), and selected by 1 mg/mL puromycin for 3 weeks. The Control siRNA (sc-37007), Mcl-1 siRNA (sc-35877), FBW7 siRNA (sc-37547) were purchased from Santa Cruz Biotechnology (Dallas, TX). Cells were grown in 6-well plates and transfected with 100 pmol small interfering RNA oligonucleotide using HiPerFect transfection reagent (Cat. 301705, Qiagen) for 72 h as described previously [18 (link)]. Cells were harvested for protein extraction and immunoblotting to confirm Mcl-1 or FBW7 knockdown.

shRNA vectors were obtained from the RNA Interference Screening Facility of Dana Farber Cancer Institute or Addgene, sequences as follows: shGLS-1, GCACAGACATGGTTGGTATAT (TRCN0000051135); shGLS-2, GCCCTGAAGCAGTTCGAAATA (TRCN0000051136). shGFP: 5′-GCAAGCTGACCCTGAAGTTCAT-3′ (Addgene plasmid #30323).