Synthetic siRNA targeting human Smad4 (5’-CCUGAGUAUUGGUGUUCCAUUGCUU-3’) was purchased from Invitrogen. Non-targeting scrambled siRNA (#1027280, Qiagen) was used as a control. The siRNAs were transfected at 40 nM using RNAi Max (Invitrogen), according to the manufacturer’s protocol.
Non targeting scrambled sirna
Manufactured by Qiagen
Non-targeting scrambled siRNA is a laboratory reagent used in RNA interference experiments. It serves as a negative control to help researchers evaluate the specificity of their targeted siRNA. The core function of this product is to provide a non-targeting siRNA sequence that does not have any known complementary targets in the tested system.
Automatically generated - may contain errors
2 protocols using non targeting scrambled sirna
1
Silencing Human Smad4 Using siRNA
2
Optimized Plasmid and siRNA Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids containing target gene, shRNA, or empty vector were transfected into cells using effectene transfection reagent (QIAGEN) following the manufacturer's instructions, followed by PBS rinse 6 h after transfection. CerS6, Drp1, p53, Rb, and E2F1, 4, and 5 shRNAs were from the MUSC shRNA Shared Technology Resource. siRNA transfections were performed using DharmaFECT™ (ThermoScientific, Dharmacon). SiRNAs used: E6/E7 (ThermoScientific, custom sequence AGGAGGAUGAAAUAGAUGGUU); CerS1, ATG5, LC3B (Thermo Scientific, Dharmacon); or non‐targeting scrambled siRNA (Qiagen).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!