DNA from each yeast isolate was extracted using the Wizard® Genomic Kit (Promega, Madison, WI, USA) with a pre-incubation step of 1 h with lyticase (0.5 mg·mL−1) [13 (link)]. ITS amplicons were obtained with ITS1 (5′- TCCGTAGGTGAACCTGCGG-3′) [14 ] and NL4 (5′-GGTCCGTGTTTCAAGACGG-3′) primers [15 ]. PCR reactions were performed in 50 µL containing 0.5 µL of ITS1 and NL4 primers (both 20 µM); 25 µL of GoTaq® G2 Green Master Mix 2X (Promega, Madison, WI, USA); 1.7 µL yeast DNA (100 ng µL −1) and 22.3 µL of nuclease-free H2O. PCR consisted of an initial denaturation at 95 °C for 5 min, followed by 30 cycles comprising a denaturation at 94 °C for 30 s, annealing at 50 °C for 30 s and an extension at 72 °C for 1.5 min and 10 extra minutes at 72 °C. To identify yeast isolates, PCR products were purified and sequenced with ITS1 primers by Psomagen USA services.
Gotaq g2 green master mix 2x
Manufactured by Promega
Sourced in United States
GoTaq® G2 Green Master Mix 2X is a ready-to-use solution for PCR amplification. It contains GoTaq® G2 DNA Polymerase, dNTPs, MgCl2, and a green dye for visualization of PCR products during gel electrophoresis.
Automatically generated - may contain errors
Lab products found in correlation
Wizard genomic kit, by Promega (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Sensifast sybr no rox kit, by Meridian Bioscience (1 mentions)
Minelute reaction cleanup kit, by Qiagen (1 mentions)
Qbase 3, by CellCarta (1 mentions)
Thermal cycler, by Bio-Rad (1 mentions)
Rneasy plus micro kit, by Qiagen (1 mentions)
3 protocols using gotaq g2 green master mix 2x
1
Yeast DNA Extraction and ITS Amplification
2
RNA Isolation and Quantitative PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated by using the RNeasy Plus Micro Kit (Qiagen) according to manufacturer’s protocol. Amplified cDNA was prepared by using the Ovation PicoSL WTA System V2 kit (TECAN) and cleaned up with the MinElute Reaction Cleanup kit (Qiagen). Conventional PCR was performed with GoTaq G2 Green Master Mix 2X (Promega) on a thermal cycler (BioRad). The following primers were used for conventional PCR amplification of total Xbp1: Fwd: 5’-ACACGCTTGGGAATGGACAC-3’ and Rev: 5’-CCATGGGAAGATGTTCTGGG-3’ (21 (link)); and for beta actin (Actb): Fwd 5’-GTGACGTTGACATCCGTAAAGA-3’ and Rev: 5’-GCCGGACTCATCGTACTCC-3’. PCR products were analyzed on agarose gels. RT-qPCR was performed with the SensiFAST SYBR No-ROX kit (Bioline) on a LightCycler 480 (Roche). mRNA expression was analyzed using qbase+ 3.2 (Biogazelle). The following primers were used for RT-qPCR: Ern1 (exon19-20): Fwd: 5’-TGCTGAAACACCCCTTCTTC-3’ and Rev: 5’-GCCTCCTTTTCTATTCGGTCA-3’. Xbp1 (exon2): Fwd: 5’-CAGCAAGTGGGGATTTGG-3’ and Rev: 5’-CGTGAGTTTTCTCCCGTAAAAG-3’. Ywhaz: Fwd: 5’-CTCTTGGCAGCTAATGGGCTT-3’ and Rev: 5’-GGAGGTGGCTGAGGATGGA-3’. Sdha: Fwd: 5’- TTTCAGAGACGGCCATGATCT -3’ and Rev: 5’-TGGGAATCCCACCCATGTT-3’.
3
RAPD Profiling of Strawberry Salt Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1-DNA extraction: The DNA was extracted from fresh leaf tissues and used as templates for four RAPD reactions to investigate the variation between strawberry samples in response to different Na Cl treatments and EMS. 2-RAPD PCR technique: RAPD markers were used to detect the possible genetic variation between treated and untreated samples in response to salt stress. Four oligonucleotide primers were used in this study (OPA-5: 5' AGG GGT CTT G 3' ; OPA-1: 5' CAG GCC CTT C 3' ; OPA-7: 5' GAA ACG GGT G 3' ; OPA-8: 5' GTG ACG TAG G 3'). 3-PCR reactions were carried out in 25 μl volumes tube containing 2μl of 34 ng/μl-1 genomic DNA, 1 μl oligoprimer, DNA master mix (GoTaq@ G2 GreenMaster Mix 2X, Promega). The thermal cycler was programmed with an initial step of 5 min at 94 °C that was followed by 35 repeated cycles for 1 min at 94 °C, an annealing step of 1 min at 36 °C and an elongati on step of 2 min at 72 °C and finally, a 7 min extension at 72 °C. Ladder contains 1500 bp was used. Amplification products were separated on 1.5% agarose with EtBr stain, diluted with 100 ml of 10x TBE (Dongsheng Biotech). PCR products were visualized on UV light and photographed using a gel documentation system.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!