Viia7 real time pcr machine

RNA was extracted from unsorted, FACS-sorted d2EGFP⁺ and d2EGFP⁻ cells of d2EGFP TBX4B and d2EGFP TBW 11.50 clones using RNeasy plus mini kit (Qiagen). cDNA was synthesised from RNA using transcriptor first strand cDNA synthesis kit (Roche) with random hexamer primers. Each RNA sample included a no reverse transcriptase (RT) control to confirm the absence of genomic DNA. A master mix containing template cDNA, gene-specific primers and Fast SYBR Green master mix (ThermoFisher Scientific) was used on a ViiA 7 real-time PCR machine (ThermoFisher Scientific) for kinetic PCR amplification. LinRegPCR method [62 (link)] was used to determine the relative abundance of target mRNAs. The gene-specific values were normalised to their corresponding 18S rRNA values, which served as the internal PCR control. The gene-specific primers are listed in the S2 Table.

Total RNA was extracted from HEK293T cells 48 h after transfection with a miR-27a mimic using the TRIZOL method, as previously described [41 (link)]. For miRNA levels, reverse transcription was performed with the TaqMan MicroRNA Reverse Transcription Kit, according to manufacturer’s instructions, followed by real-time PCR using TaqMan assays (miR-27a: assay ID 000408 and U6 SNRNA assay ID 001973). To determine mRNA levels of DPYD and GAPDH, cDNA was created using the iScript reverse transcription kit (BioRAD). Real-time PCR was performed using SYBR green reagents and specific primers (DPYD forward: GGTGGTGATGTCGTTGGTTT, DPYD reverse: GCAGAAACGGAAGCTCCATA, GAPDH forward: ACCACAGTCCATGCCATCAC, GAPDH reverse: TCCACCACCCTGTTGCTGTA). All real-time PCR was performed using a Viia7 Real-Time PCR machine (ThermoFisher). Relative expression was calculated using the ΔΔCT method, with U6 siRNA and GAPDH used as housekeeping genes for miR-27a and DPYD, respectively.

LPA receptor mRNA levels in tissues and cells were determined using qPCR using validated optimal reference gene pairs as previously described [28 (link)]. Primer information for LPA receptor and reference genes is provided in Table 2. Ground tissue samples and harvested cells were homogenized in Ribozol (Amresco), RNA was isolated as per the manufacturer’s instructions, and RNA quality and quantity were examined using a QIAxcel Advanced System (Qiagen). cDNA was synthesized from 1 μg of RNA using qScript cDNA supermix (Quanta Biosciences) and cDNA samples were stored at −20°C until further use. qPCR analysis was performed in 96-well plates using PerfeCTa SYBR green Supermix Low ROX (Thermo Fisher Scientific) and a ViiA7 real-time PCR machine (Thermo Fisher Scientific) as detailed previously [28 (link)]. mRNA levels were quantified using gbase + software (Biogazelle) [28 (link)].

Quantitative PCR with reverse transcription (RT–qPCR) analysis of NF-κB-responsive genes was undertaken as previously described^{61 (link)}. In brief, the TRIM5^−/−CypA^−/− cell line was modified to express inducibly either VACV TAP-tagged-L3 or empty vector. These cells were seeded in 12-well plates at a density of 6 × 10⁵ cells per well; the next day, these cells were incubated in medium without serum for 3 h and then either mock-treated or treated with doxycycline (150 ng ml⁻¹) for 4 h in triplicate. Total RNA was extracted from the cells and cDNA was synthesized by reverse transcription using oligo-dT primers (Thermo Fisher). The mRNA levels of the NF-κB-responsive genes NFKBIA, CCL2, CXCL8, CXCL10, IL6 and the housekeeping control gene GAPDH were measured by qPCR using Fast SYBR Green master mix (Thermo Fisher) and a ViiA 7 real-time PCR machine (Thermo Fisher). The fold induction of the mRNA levels was calculated by the 2^−ΔΔCt method using induced T-REx-293 empty vector and GAPDH as the internal control. The primers used in the qPCR are listed in Supplementary Table 2.

Total RNA was extracted from LNCaP cells by using TRIZOL Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Next, total RNA (2 µg) was reverse-transcribed into cDNA by using GoScript Reverse Transcription Kit (Promega, Madison, WI, USA). Subsequently, RT-PCR was conducted in Thermal Cycler (T100, Bio-Rad, Hercules, CA, USA). PCR products were electrophoresed in agarose gel, visualized by EtBr-imaging (GelDoc XR+; Bio-Rad, Hercules, CA, USA). The quantitative PCR (qPCR) was conducted using FastSYBR Green qPCR Master Mix (Life Technologies) and Viia7 real-time PCR machine (Thermo Fisher Scientific). Changes in expression levels were calculated as the ratio of the treated sample to control samples. All samples were normalized to the expression of the GAPDH mRNA.
Primers used for PCR were as follows: AHR: 5′-TCAAATCCTTCCAAGCGGCA-3′ (Sense) and 5′-ACAGTTATCCTGGCCTCCGT-3′ (Antisense); AR: 5′-CAGGTGGAGGCAAATCTTCGT-3′ (Sense) and 5′-CCTGCAATCTGCCAATGG-3′ (Antisense); ARNT: 5′-GGTTTGGCAGCACACTCTATG-3′ (Sense) and 5′-ACAGTTATCCTGGCCTCCGT-3′ (Antisense); CYP1A1: 5′-CAAGGGGCGTTGTGTCTTTG-3′ (Sense) and 5′-GTCGATAGCACCATCAGGG-3′ (Antisense); GAPDH: 5′-CGGAGTCAACGGATTTGGTCGTAT-3′ (Sense) and 5′-AGCCTTCTCCATGGTGGTGAAGA-3′ (Antisense).

Stress-tolerant genotype DBA Aurora and stress-sensitive genotype L6 (based on the rank summation index in Table 1) were selected for gene expression analysis. Flag leaf samples from each treatment group were collected at 5, 15, 25, 35 and 45DPA with sterile razor blades and were snap-frozen in liquid nitrogen. Three biological replicates were collected for each treatment at each time-point. Total RNA was extracted using the Tri reagent (Sigma-Aldrich) and treated with TURBO DNase (ThermoFisher Scientific) following the manufacturer’s instructions. The concentration and quality of RNA samples were measured on a NanoDrop Lite spectrophotometer (ThermoFisher Scientific). RNA integrity was assessed by agarose gel electrophoresis and Bioanalyzer. cDNA was synthesized using the MystiCq microRNA cDNA Synthesis Mix Kit (Sigma-Aldrich) as previously described^{24 (link)}. qPCR analysis of miR160a and the ARFs (ARF8 and ARF18), miR396b and the HSP90s (CL1Contig1941, Contig102950, KukriC15_415)^{24 (link),38 (link)} was performed using the PowerUp SYBR Green Master Mix (ThermoFisher Scientific) on a ViiA7 Real-Time PCR machine as previously described^{24 (link),38 (link)}. GAPDH was used as the reference gene. Primer sequences used in the study are included in Supplementary Table S4.