The PCR mixture was as follows: 5 µl Taq buffer (10X), 1 µl dNTP mixture (2.5 mM), 1.0 µl each primer 20 pmol (forward: 5′-CTACTATTGCCAGCATTGCTGC-3′; reverse: 5′-GGCAAATGGCATTCTGACATCCT-3′), 1.0 µl Taq polymerase (Takara Bio, Inc.), 1.0 µl genome DNA template and 5.0 µl DDH2O, giving a total reaction volume of 36.0 µl. The thermal cycling conditions were as follows: 94°C for 3 min, followed by 25 cycles of 94°C for 30 sec, 55°C for 45 sec and 72°C for 1 min, then 72°C for 10 min and finally held at 4°C. PCR (GeneAmp 9600 PCR system; PerkinElmer, Waltham, MA, USA) was performed. All experiments were performed in triplicate. PCR products were detected using 1% agarose gel.
Geneamp pcr system 9600
Manufactured by PerkinElmer
Sourced in United States, China
The GeneAmp PCR System 9600 is a thermal cycler designed for polymerase chain reaction (PCR) amplification. It features a 96-well sample block and can perform automated thermal cycling to facilitate the amplification of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Superscript 3 first strand synthesis system for rt pcr, by Thermo Fisher Scientific (3 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
Taq dna polymerase, by Takara Bio (2 mentions)
Gtagccatattcattgtcata 3, by Integrated DNA Technologies (2 mentions)
Abi prism 7000 sequence detector pcr system, by Thermo Fisher Scientific (2 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (2 mentions)
7900ht real time pcr system, by Thermo Fisher Scientific (2 mentions)
Ncode express sybr greener mirna qpcr kit, by Thermo Fisher Scientific (2 mentions)
Taq dna polymerase, by PerkinElmer (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
Taq polymerase, by Takara Bio (1 mentions)
Biospectrometer, by Eppendorf (1 mentions)
Faststart universal sybr green master, by Vazyme (1 mentions)
Transscript rt reagent kit, by Transgene (1 mentions)
Taq dna polymerase, by Roche (1 mentions)
49 protocols using geneamp pcr system 9600
1
Amplification of Genomic DNA Sequences
2
Comprehensive Transcriptional Analysis of Cellular Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using RNAiso Plus (TaKaRa, Japan, 108‐95‐2) and isolated according to the manufacturer's instructions. The RNA concentration and purity were measured by a BioSpectrometer (Eppendorf, Germany); 2 μg total RNA was reversely transcribed into cDNA using the TransScript RT reagent Kit (TransGen, China, AE301). According to the manufacturer's instructions, qRT‐PCR was performed with FastStart Universal SYBR Green Master (Vazyme, China, Q111) using a Gene Amp 9600 PCR system (Perkin‐Elmer, Waltham, MA). The relative amount of cDNA was analyzed using the 2−ΔΔCT method. The primers for qRT‐PCR used in this study were as follows: PDHA1‐Forward: CTTACCGCTACCATGGACACAGCATG,
Reverse: CTCCTTTAATTCTTCAACACTTGCAAGA; HK2‐Forward: GAGCCACCACTCACCCTACT, Reverse: CCAGGCATTCGGCAATGTG; PFK2‐Forward: ATTGCGGTTTTCGATGCCAC, Reverse: GCCACAACTGTAGGGTCGT; IDH1‐ Forward: TTGGCTGCTTGCATTAAAGGTT, Reverse: GTTTGGCCTGAGCTAGTTTGA; CS‐Forward: GAGCAGGCCAGAGTTAAGAC, Reverse: AAAATAAGCCCTCAGGTAGG; LDHA‐Forward: AAACGCGCCTTAATTTAGTCCA, Reverse:CAGCCGCTTCCAATAATACGG; PGC1α‐Forward: GTAAATCTGCGGGATGATGG, Reverse: AGCAGGGTCAAAATCGTCTG; SIRT1‐Forward: TGCCATCATGAAGCCAGAGA, Reverse: AACATCGCAGTCTCCAAGGA; and GAPDH‐Forward:CAAGAAGGTGGTGAAGCAGG, Reverse: CCACCCTGTTGCTGTAGCC.
Reverse: CTCCTTTAATTCTTCAACACTTGCAAGA; HK2‐Forward: GAGCCACCACTCACCCTACT, Reverse: CCAGGCATTCGGCAATGTG; PFK2‐Forward: ATTGCGGTTTTCGATGCCAC, Reverse: GCCACAACTGTAGGGTCGT; IDH1‐ Forward: TTGGCTGCTTGCATTAAAGGTT, Reverse: GTTTGGCCTGAGCTAGTTTGA; CS‐Forward: GAGCAGGCCAGAGTTAAGAC, Reverse: AAAATAAGCCCTCAGGTAGG; LDHA‐Forward: AAACGCGCCTTAATTTAGTCCA, Reverse:CAGCCGCTTCCAATAATACGG; PGC1α‐Forward: GTAAATCTGCGGGATGATGG, Reverse: AGCAGGGTCAAAATCGTCTG; SIRT1‐Forward: TGCCATCATGAAGCCAGAGA, Reverse: AACATCGCAGTCTCCAAGGA; and GAPDH‐Forward:CAAGAAGGTGGTGAAGCAGG, Reverse: CCACCCTGTTGCTGTAGCC.
3
Rapid Bacillus Identification via RAPD-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA extracted from pure culture of Bacillus strains was subjected to RAPD-PCR technique using the S30 primer, previously described to rapidly identify Bacillus species in fermented food (Kwon et al. 2009 and Lee et al. 2011) . RAPD-PCR assays were carried out in 25 µl reaction volume containing a final concentration of 1X KAPA Taq buffer (Biosystem), 0.2 µM of dNTP, 0.4 µM of S30 primer, 3 U KAPA Taq DNA polymerase, and 100 ng of template DNA. PCR was performed using GeneAmp 9600 PCR system (Perkin Elmer, Applied Biosystem, USA) and PCR conditions were: 94 °C for 5 min, 40 cycles of 94 °C for 15 s, 35.5 °C for 15 s, and 72 °C for 2 min, and final extension at 72 °C for 4 min (Kwon et al. 2009 ). The reproducibility was evaluated amplifying each isolate three times and running each DNA fragment for duplicate.
The presence and absence of RAPD-PCR products were recorded and assembled in a data matrix. The Dice similarity coefficient was used to estimate the genetic similarity (Dice 1945) . A dendrogram was generated from a similarity matrix using the Unweighted Pair Group Method with the Arithmetic Mean (UPGMA) algorithm using NTSYS-pc version 2.11 software (Rohlf 2002) . The cophenetic correlation coefficient (CCC) was calculated as suggested by Sneath & Sokal (1973) .
The presence and absence of RAPD-PCR products were recorded and assembled in a data matrix. The Dice similarity coefficient was used to estimate the genetic similarity (Dice 1945) . A dendrogram was generated from a similarity matrix using the Unweighted Pair Group Method with the Arithmetic Mean (UPGMA) algorithm using NTSYS-pc version 2.11 software (Rohlf 2002) . The cophenetic correlation coefficient (CCC) was calculated as suggested by Sneath & Sokal (1973) .
4
Automated APOE Genotyping from Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was extracted from 2mL of peripheral venous blood (in tubes containing EDTA anticoagulant) and stored at -80 degree Celsius until thawed for analysis. Using Baio R-Hyb automated hybridisation instrument (Shanghai BaiO Technology Company Ltd., Shanghai, China), a commercial APOE gene detection kit and analysing equipment, gene chips placed in the BaiO BE-2.0 Gene Chip Readerware were analysed. Genotyping was carried out by polymerase chain reaction-based ligase detection reaction using PerkinElmer GeneAmp 9600 PCR System (PerkinElmer, Shanghai, China). Accuracy of genotyping was ensured using duplicate samples and negative controls.
5
RAPD-PCR Amplification Optimization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amplification reactions were carried out on a Gene Amp PCR System 9600 thermocycler (Perkin-Elmer, Waltham, MA, USA). RAPD-PCR conditions for all primers used included 42 cycles. The temperature and duration for each profile was the following: denaturation at 94 °C for 1 min, annealing at 36 °C for 1 min, and elongation at 72 °C for 1 min. The final elongation was run at 72 ° C for 7 min complete cycles.
The initial 25 μL PCR optimal reaction mixture contained 10 × PCR buffer (100 mmol/L Tris-HCl, 500 mmol/L KCl, pH 8.3), 1U of Taq DNA polymerase (Roche Diagnostics GmbH, Mannheim, Germany), 30 ng/L DNA template, 2.5 mmol/L MgCl2, 2 mmol/L dNTPs, and 20 pmol/L for each primer (RP2 and 1247).
The initial 25 μL PCR optimal reaction mixture contained 10 × PCR buffer (100 mmol/L Tris-HCl, 500 mmol/L KCl, pH 8.3), 1U of Taq DNA polymerase (Roche Diagnostics GmbH, Mannheim, Germany), 30 ng/L DNA template, 2.5 mmol/L MgCl2, 2 mmol/L dNTPs, and 20 pmol/L for each primer (RP2 and 1247).
6
Titanium Particle-Induced Osteoclastogenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Macrophage colony stimulating factor (M-CSF) and receptor activator of NF-KB ligand (RANKL) factor were obtained from Sigma (St Louis, MO). Titanium particle was supplied by Nonferrous Metals Company (Beijing, China) with a mean diameter of 91 ± 15 μm. Trizol was purchased from Invitrogen (Carlsbad, CA). RANK ELISA kit was obtained from Xitang Biology Sci-tech Co., Ltd (Shanghai, China). The primers for tartrate-resistant acid phosphatase (TRAP), CA II, matrix metalloproteinase 9 (MMP-9), Cathepsin K (CtsK) and GAPDH were supplied by Sangon Biological Engineering Technology & Services Co., Ltd (Shanghai, China). The cDNA Synthesis and SYBR Premix Ex Taq polymerase chain reaction (PCR) Kits were purchased from TaKaRa (Shiga, Japan). The antibodies for TRAP, RANK, CtsK and β-actin were purchased from Cell Signaling Technology (Beverly, MA). GeneAmp PCR System 9600 was purchased from Perkin Elmer. The 7500 Real-Time PCR Systems was supplied by Applied Biosystems. Finally, the TRAP Staining Kit was obtained from Jian Cheng Bioengineering Institute (Nanjing, China).
7
qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) from mouse tissue segments (~5 mm long) and was reverse transcribed into cDNA with PrimeScript™ RT reagent kit with gDNA Eraser (Takara Bio, Inc., Otsu, Japan). qPCR was performed using the SYBR PremixEx Taq™ II (Takara Bio, Inc., Otsu, Japan) on a Real-Time PCR System (GeneAmp PCR System 9600, PerkinElmer, Inc., Waltham, MA, USA) under the following cycling conditions: Initial denaturation at 95°C for 30 sec; followed by 40 cycles of 95°C for 5 sec and 60°C for 30 sec. Melting curve analysis was performed to ensure amplification of single PCR products. β-actin was used as an endogenous control. All experiments were performed in triplicate. Reactions with no template were included as negative controls. Relative mRNA expression levels of target genes were calculated using the 2−ΔΔCq method (16 (link)). Results were expressed as a fold-change relative to the control animals. Primers were synthesized by Sangon Biotech Co., Ltd., (Shanghai, China; Table II ).
8
Endothelial Cell Activation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HAECs were seeded
onto collagen sheets or individual wells of 6-well plates, as described
above. Following exposure to TNF-α, cells were washed three
times with PBS, and RNA was isolated using the RNeasy Mini Kit (Qiagen).37 (link),38 (link) RNA quantification was performed using a NanoDrop ND-1000 Spectrophotometer
(Thermo Fisher Scientific) and reverse transcription was performed
using 0.5 μg of total RNA per sample with the High Capacity
cDNA Reverse Transcription Kit (Applied Biosystems) using the GeneAmp
PCR System 9600 (PerkinElmer). qPCR was performed using the ViiA 7
Real-Time PCR System (Thermo Fisher Scientific) and accompanying software.
TaqMan Universal PCR Master Mix (Applied Biosystems) and TaqMan probes
were used for ICAM1 (Hs00164932_m1) and VCAM1 (Hs01003372_m1), as
markers of activation, and RPLPO (Hs00420895_gH), as a housekeeping
gene. Cycle threshold (Ct) raw data values were analyzed using the
delta–delta Ct method to determine whether there were changes
in markers of endothelial cell activation between groups.
onto collagen sheets or individual wells of 6-well plates, as described
above. Following exposure to TNF-α, cells were washed three
times with PBS, and RNA was isolated using the RNeasy Mini Kit (Qiagen).37 (link),38 (link) RNA quantification was performed using a NanoDrop ND-1000 Spectrophotometer
(Thermo Fisher Scientific) and reverse transcription was performed
using 0.5 μg of total RNA per sample with the High Capacity
cDNA Reverse Transcription Kit (Applied Biosystems) using the GeneAmp
PCR System 9600 (PerkinElmer). qPCR was performed using the ViiA 7
Real-Time PCR System (Thermo Fisher Scientific) and accompanying software.
TaqMan Universal PCR Master Mix (Applied Biosystems) and TaqMan probes
were used for ICAM1 (Hs00164932_m1) and VCAM1 (Hs01003372_m1), as
markers of activation, and RPLPO (Hs00420895_gH), as a housekeeping
gene. Cycle threshold (Ct) raw data values were analyzed using the
delta–delta Ct method to determine whether there were changes
in markers of endothelial cell activation between groups.
9
RT-PCR Analysis of MUC3 and MUC5B in Gallbladder
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse-transcription polymerase chain reaction (RT-PCR) was used to determine expression of MUC3 and MUC5B genes in gallbladder tissue and DGBECs. The primers used were as follows: MUC3 forward, 5′-TGT CAG CTC CAG ACC AGA TG-3′; reverse, 5′-CCT GCT CAT ACT CGC TCT CC-3′; MUC5B forward, 5′-ATG AAA CCT GGG TCA ACA GC-3′; reverse, 5′-ATC CAC GTG GGT GTA GGT GT-3′. Primers (10 mM) were combined with 0.1 μg/mL total RNA, 5 mM MgCl2, 10 mM dNTPs, 2.5 U Taq polymerase (Promega, Medison, WI, USA), and ddH2O at reaction volumes of 50 μL. Amplification was performed with a GeneAmp PCR system 9600 (Perkin Elmer, Norwalk, CT, USA) in the following steps: 5 minutes of denaturation at 94°C; 35 cycles of 30 seconds at 94°C, 30 seconds at 60°C, and 2 minutes at 75°C; and final extension for 5 minutes at 72°C. PCR products were visualized on 2% agarose gels stained with ethidium bromide (0.5 μg/mL). Final analysis was conducted with the Quantity One program of a Fluor-STM Multi-Imager (Bio-Rad, Hercules, CA, USA).
10
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 10 to 30 mg fresh-frozen tissue using the High Pure RNA Tissue Kit (#12033674001, Roche Diagnostics Scandinavia AB) according to the manufacturer’s instructions. cDNA was synthesized using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and run on Gene Amp PCR System 9600 (Perkin Elmer). To optimize each run, the expression level of β-actin was determined in each sample. A second RNA extraction and cDNA synthesis was performed if the concentration was considered to be suboptimal.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!