Qscript one step sybr green qrt pcr kit

Manufactured by Quanta Biosciences

Sourced in United States

The QScript One-Step SYBR Green qRT-PCR kit is a reagent system for performing one-step reverse transcription and quantitative real-time PCR amplification of RNA targets. The kit includes all necessary components for cDNA synthesis and real-time PCR detection using SYBR Green chemistry.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

QScript kit SYBR Green

9 protocols using qscript one step sybr green qrt pcr kit

Quantitative PCR for Friedreich's Ataxia

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polymerase chain reaction (PCR) conditions to measure GAA•TTC repeat length were described previously.^{21 (link)} Quantitative reverse transcriptase PCR (qRT-PCR) was performed using the qScript One-Step SYBR Green qRT-PCR kit from Quanta Biosciences (Gaithersburg, MD) according to the manufacturer’s instructions. qRT-PCR reactions were detected on a PTC-200 thermal cycler with the Chromo4 real-time module (MJ Research, Waltham, MA). Primers to detect FXN mRNA were previously described.^{6 (link)} Primers for neuronal characterization were as follows: MAP2-R1 (5′-CAGGAGTGATGGCAGTAGAC-3′), MAP2-F2 (5′-TTTGGAGAGCATGGGTCAC-3′) for the MAP2 gene, HUC-F1 (5′-GGTTCGGGACAAGATCACAG-3′), and HUC-R1 (5′-CTGAACTGGGTCTGGCATAG-3′) for the ELAVL3 gene. qRT-PCR primers for pluripotency mRNA markers were as previously published.^{20 (link)} Neuronal cell gene expression profiling was performed on Illumina (San Diego, CA) HT12 arrays, and statistical analysis was as described in Ku et al.^{20 (link)}

Soragni E., Miao W., Iudicello M., Jacoby D., De Mercanti S., Clerico M., Longo F., Piga A., Ku S., Campau E., Du J., Penalver P., Rai M., Madara J.C., Nazor K., O’Connor M., Maximov A., Loring J.F., Pandolfo M., Durelli L., Gottesfeld J.M, & Rusche J.R. (2014). Epigenetic Therapy for Friedreich Ataxia. Annals of neurology, 76(4), 489-508.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of TMPRSS2-ERG Fusion Gene

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qRT-PCR, total RNA (500 ng) was transcribed into cDNA using qScript™ cDNA Synthesis Kit (Quanta Biosciences, Gaithersburg, MD). Real-time RT-PCR reactions were performed using qScript™ One-Step SYBR^® Green qRT-PCR kit (Quanta Biosciences, Gaithersburg, MD) and the following TMPRSS2-ERG fusion gene-specific primers: TMPRSS2-ERG RT forward, 5’-CAGGAGGCGGAGGCGGA-3’; TMPRSS2-ERG RT reverse, 5’-GGCGTTGTAGCTGGGGGTGAG-3’ and human GAPDH forward, 5’-GAGTCAACGGATTTGGTCGT-3’, and reverse, 5’-TTGATTTTGGAGGGATCTCG-3’ were used (25 (link)). qRT-PCR reactions were run on an ABI Prism 7000 Sequence Detection System (Thermoscientific, Grand Island, NY). Data were analyzed using the ΔΔCt method (26 (link)), where target gene expression is normalized to the housekeeping gene by taking the difference between Ct values for target gene and housekeeping gene (ΔCt). This value was then compared to that of the normalized control sample (ΔΔCt). The fold change was then determined by the formula: 2^−ΔΔCt.

Udayakumar T.S., Stoyanova R., Shareef M.M., Mu Z., Philip S., Burnstein K.L, & Pollack A. (2016). Edelfosine Promotes Apoptosis in Androgen Deprived Prostate Tumors by Increasing ATF3 and Inhibiting Androgen Receptor Activity. Molecular cancer therapeutics, 15(6), 1353-1363.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with Trizol (Invitrogen). 200–300 ng of total cellular RNA was used with the qScript One-Step SYBR Green qRT-PCR Kit (Quanta Biosciences). Primers used for human HMG-CoA Reductase were: TGTGTGTGGGACCGTAATGG and ACCAAGTGGCTGTCTCAGTG; and for human GAPDH: ACAGTCAGCCGCATCTTCTT and GCATCGCCCCACTTGATTTT.

Nelson R.K., Ya-Ping J., Gadbery J., Abedeen D., Sampson N., Lin R.Z, & Frohman M.A. (2017). Phospholipase D2 loss results in increased blood pressure via inhibition of the endothelial nitric oxide synthase pathway. Scientific Reports, 7, 9112.

+ Open protocol

+ Expand

Quantification of Urease Gene Expression in H. pylori

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

One step qRT-PCR was completed from RNA with the qScript One-Step SYBR^® Green qRT-PCR Kit (Quanta Biosciences), using a Bio-Rad iCycler CFX-96 machine. Primer design was aided by the Primer3 software available at http://www-genome.wi.mit.edu/genomesoftware/other/primer3.html (16 (link)). Unique primers were designed for 100–300 base pair regions of each gene in the urease gene cluster and a housekeeping gene (Table 2).
Standard PCR performed with genomic DNA from H. pylori strain G27 as the template was used to assure that all primer pairs resulted in amplification of a single product (data not shown). qPCR was completed using 10 QL reactions in a 96 well plate using the standard cycling protocol, conditions were 50o for 10 minutes, 95° for 5 minutes, followed by 45 cycles of 95o for 10 seconds, 60o for 30 seconds (data collection). Threshold cycle was calculated using the Bio-Rad software. A melting curve was used at the end of the run to confirm that there was only one peak and only one product for each primer. Results were analyzed using the comparative C_T method (16 (link), 17 (link)) with gyrB used as a housekeeping gene. RNA isolation was completed two times for each condition, and each RNA sample was run in triplicate. Non-acidic pH (pH 7.4) was used as the denominator for comparison with acidic pHs (pH 3.0, 4.5, and 6.0).

Marcus E.A., Sachs G, & Scott D.R. (2018). Acid regulated gene expression of Helicobacter pylori: insight into acid protection and gastric colonization. Helicobacter, 23(3), e12490.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cultured IMC, freshly isolated muscle strips or crypts (as the control) with a Qiashredder (Qiagen, Germantown, MD) and RNeasy kit (Qiagen). Quantitative real-time RT-PCR was carried out with QuantiTect Probe RT-PCR kit (Qiagen) on the 7500 Real Time PCR System (Applied Biosystems, Invitrogen). Relative expression was calculated based on the ΔΔCt method with Gapdh as reference. For human markers, MYH11, C-KIT, TUBB3, GFAP and GAPDH, real-time RT-PCR was performed with qScript™ One-Step SYBR® Green qRT-PCR Kit (Quanta Biosciences, Beverly, MA). Validated primers and probes used here were listed in S1 Table.

Wang Q., Wang K., Solorzano-Vargas R.S., Lin P.Y., Walthers C.M., Thomas A.L., Martín M.G, & Dunn J.C. (2018). Bioengineered intestinal muscularis complexes with long-term spontaneous and periodic contractions. PLoS ONE, 13(5), e0195315.

+ Open protocol

+ Expand

Quantitative Analysis of Staphylococcus aureus Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Separate quantification of gene expression from S. aureus JE2 was determined by quantitative Reverse Transcriptase PCR (qRT-PCR) from the original non-rRNA-depleted RNA samples and additional experimental samples generated under identical conditions. RNA preparation with DNA removal was performed as above and 0.5 ng of total RNA was used for qRT-PCR with a qScript One-Step SYBR Green qRT-PCR kit (Quanta Biosciences) to determine overall transcript abundance in each experimental condition. We used primers oKL311 and oKL312 to measure spa transcript abundance and oKL339 and oKL340 to measure gyrB abundance as an internal control. Controls lacking reverse transcriptase were also performed to verify lack of contaminating DNA. Comparisons of relative abundance of spa expression normalized to gyrB expression per sample were used to calculate fold change of spa expression and compared to RNAseq data under the same conditions (Table 1).

Ramsey M.M., Freire M.O., Gabrilska R.A., Rumbaugh K.P, & Lemon K.P. (2016). Staphylococcus aureus Shifts toward Commensalism in Response to Corynebacterium Species. Frontiers in Microbiology, 7, 1230.

+ Open protocol

+ Expand

Quantification of miRNA-128 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA, including miRNA, was extracted from cells using the miRNeasy Mini Kit (QIAGEN, Mississauga, ON, Canada). cDNA for gene expression was synthesized using oligo-dT and reverse transcriptase (Thermo Fisher Scientific). cDNA of miRNA-128 was synthesized using the qScript microRNA cDNA synthesis kit (Quanta Biosciences, San Francisco, CA, USA) or miScript II RT Kit (QIAGEN) according to the manufacturers’ instructions. The cDNA was then subjected to quantitative PCR (qPCR) with respect to miRNA-128 expression using the qScript One-Step SYBR Green qRT-PCR kit (Quanta Biosciences) or miScript SYBR Green PCR Kit (QIAGEN). qPCR was performed using the CFX Connect Real-Time PCR Detection System (Bio-Rad, Mississauga, ON, Canada). SNORD61 (QIAGEN) was used as an internal loading reference. PCR cycling conditions for qScript One-Step SYBR Green qRT-PCR kit were as follows: 95°C for 2 min followed by 40 cycles of 95°C for 5 s, 60°C for 30 s, and 72°C for 30 s, or 95°C for 15 min followed by 40 cycles of 94°C for 15 s, 55°C for 30 s, and 72°C for 30 s for the miScript SYBR Green PCR Kit.

Zhao D., Shun E., Ling F., Liu Q., Warsi A., Wang B., Zhou Q., Zhu C., Zheng H., Liu K, & Zheng X. (2019). Plk2 Regulated by miR-128 Induces Ischemia-Reperfusion Injury in Cardiac Cells. Molecular Therapy. Nucleic Acids, 19, 458-467.

+ Open protocol

+ Expand

Quantitative RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from HGE-20 cells following 12 hour incubation with FCF or vehicle using a combination of the Trizol^® method (ThermoFisher) and the RNeasy mini kit (Qiagen, Valencia, CA, USA) as described previously [57 (link)]. RNA concentration was measured on a nanodrop machine (Thermo Scientific) and RNA quality was confirmed on an Agilent Bioanalyzer using the RNA nano 600 kit (Agilent Technologies, Santa Clara, CA, USA). All RNA used in this study had an RNA integrity number of 10. The qScript one-step SYBR^® green qRT-PCR kit was used for cDNA construction and qPCR (Quanta Biosciences, Gaithersburg, MD, USA). qPCR was completed on an Applied Biosystems 7500 thermo cycler (ThermoFisher) with annealing temperature of 60°. All samples (vehicle and FCF) were run in triplicate, and PCRs were run in triplicate with each sample for a total of 3 biologic replicates and 3 technical replicates for each condition. GAPDH was used as a housekeeping gene to normalize results. Results were analyzed using the comparative C_T method [58 (link)]. Primers for qPCR were as follows: erbB2-s 5′-AATTCCAGTGGCCATCAAAG-3′; erbB2-as 5′-TTTCCCGGACATGGTCTAAG-3′; GAPDH-s 5′-ACCCAGAAGACTGTGGATGG-3′; GAPDH-as 5′-TTCTAGACGGCAGGTCAGGT-3′.

Marcus E.A., Tokhtaeva E., Turdikulova S., Capri J., Whitelegge J.P., Scott D.R., Sachs G., Berditchevski F, & Vagin O. (2016). Septin oligomerization regulates persistent expression of ErbB2/HER2 in gastric cancer cells. The Biochemical journal, 473(12), 1703-1718.

+ Open protocol

+ Expand

GAA Triplet Repeat Length Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified with the RNeasy Plus Mini kit (QIAGEN) according to the manufacturer’s instruction. Genomic DNA was purified by isopropanol precipitation of cell lysates prepared in total cell lysis buffer (100 mM Tris, 5 mM EDTA, 0.2% SDS, 0.2 M NaCl, and 200 mg/ml proteinase K [pH 8]). For GAA triplet repeat length conventional PCR, Phusion polymerase (New England Biolabs, Ipswich, MA) was used according to the manufacturer’s instruction; 20 ng of DNA and 0.1 μM primers GAA-104F and GAA-629R (Ku et al., 2010) were used in 20 μL of reactions cycled through the following conditions: denaturation at 98°C for 5 s, annealing at 70°C for 15 s, and extension at 72°C for 90 s for 40 cycles with a 5-min initial denaturation and a 5-min final extension. Quantitation of PCR band size was performed using an inverse power function directly correlating gel migration of a molecular weight ladder to its known size. Quantitative RT-PCR analysis was performed with the qScript One-Step SYBR Green qRT-PCR Kit (Quanta Biosciences) according to the manufacturer’s instruction. Analysis of relative qRT-PCR data was performed via the 2−ΔΔCT method and normalized to GAPDH mRNA levels.

Rodden L.N., Rummey C., Dong Y.N., Lagedrost S., Regner S., Brocht A., Bushara K., Delatycki M.B., Gomez C.M., Mathews K., Murray S., Perlman S., Ravina B., Subramony S.H., Wilmot G., Zesiewicz T., Bolotta A., Domissy A., Jespersen C., Ji B., Soragni E., Gottesfeld J.M, & Lynch D.R. (2022). A non-synonymous single nucleotide polymorphism in SIRT6 predicts neurological severity in Friedreich ataxia. Frontiers in Molecular Biosciences, 9, 933788.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!