PCR products were run on a 1.5 % agarose gel and purified using Wizard PCR Preps DNA Purification System (Promega, U.S.A.). Purified PCR products were ligated into pMD 18-T easy vector (Takara, Japan) and plasmids cloned into E. coli XL1-blue competent cells. Plasmids were purified using a miniBEST plasmid purification kit (Takara, Japan). At least 30 clones of each PCR product were selected. Sequencing reactions were carried out on recombinant plasmids using M13 forward and reverse primers. Sequence alignment was performed with the Clustal W algorithm [23 (link)].
Wizard pcr preps dna purification system
Manufactured by Promega
Sourced in United States
The Wizard PCR Preps DNA Purification System is a laboratory equipment used for the purification of DNA from PCR reactions. It utilizes a silica-based membrane technology to capture and purify DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Pgem t easy vector, by Promega (3 mentions)
Pgem t easy, by Promega (3 mentions)
Jm109 competent cells, by Promega (3 mentions)
Pmd18 t vector, by Takara Bio (2 mentions)
Pmd18 t easy vector, by Takara Bio (1 mentions)
Minibest plasmid purification kit, by Takara Bio (1 mentions)
Vector nti software, by Thermo Fisher Scientific (1 mentions)
Ceq 8000, by Beckman Coulter (1 mentions)
Geneclean 3 kit, by Qbiogene (1 mentions)
Bigdye terminator cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Wizard genomic dna extraction kit, by Promega (1 mentions)
Pcr select cdna subtraction kit, by Takara Bio (1 mentions)
Pcr selecttm cdna subtraction kit, by Takara Bio (1 mentions)
Abi 310 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Pcr master mix, by Thermo Fisher Scientific (1 mentions)
One step access rt pcr system, by Promega (1 mentions)
3 race system, by Thermo Fisher Scientific (1 mentions)
Seqman, by DNASTAR (1 mentions)
Nhei hf, by New England Biolabs (1 mentions)
21 protocols using wizard pcr preps dna purification system
1
Cloning and Sequencing of PCR Products
2
Genetic Sequencing of Feline Coronavirus Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The E2-gene fragment reported by Lowings et al. [44 (link)] was amplified by end point RT-PCR [45 (link)] in sera, tonsil, lung and spleen from animals 1, 3 (Group A), 4 and 5 (Group B), collected at necropsy. Additionally, the viral inoculums used in the experimental infections (Cat01 and Margarita strains) were evaluated. The amplification products were checked by electrophoresis on 2% agarose gel and were directly cleaned with a Wizard® PCR Preps DNA Purification System (Promega, Madison, Wisconsin, USA). Sequencing reactions were conducted under BigDyeTM terminator-cycling conditions using an ABI 3130XL. Forward and reverse sequences obtained from each amplicon were assembled using the Contig Express application in Vector NTI software, version 11 (Invitrogen). The sequences from the E2-gene fragment obtained were aligned to analyse the sequence found in each sample.
3
Transposon Insertion Site Mapping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to locate the transposon insertion sites in the K-10 genome, DNA was amplified for sequencing analysis by a nested PCR as previously described (McAdam et al., 2002 (link)). A new primer designated STM5370-1, common to both transposons, was used in place of the original SP1 primer due to differences in the Tn5367 and Tn5370 transposon sequences. This primer was designed based on sequence information of Tn5370 provided Dr. Jeffrey Cirillo (Texas A&M Health Science Center) that was further supplemented by our own sequencing studies. The first PCR used the following primers: RS6-4 (degenerate) and STM5370-1. The variable size PCR products (1 μl) from the first cycle were used in a second PCR cycle with primers T7 and SP2 that are internal to the first cycle PCR product. These final PCR products were purified by Wizard PCR Preps DNA Purification System (Promega, Madison, WI). The samples were run on 1.5% agarose gel electrophoresis to recover the most concentrated DNA bands and purified by the GeneClean® III Kit (Qbiogene, MP Biomedicals, LLC, Solon, OH). DNA samples were sent to The University of Nebraska Genomics Core Research Facility for sequencing, using AMT152 as primer (Shin et al., 2006 (link)). Sample runs were performed on a Beckman-Coulter CEQ8000 or CEQ2000XL 8-capillary DNA sequencer using dye-terminator chemistry to provide 500–650 bp of sequence.
4
Bacterial 16S rRNA Gene Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA was obtained using the DNeasy Blood &Tissue Kit (QIAGEN). PCR for 16S rRNA gene amplification was performed by using the bacterial-specific primers, 27F (5′-AAGGAGGGGATCCAGCCGCA-3′) and 1492R (5′- GTGCCAGCAGCCGCGG -3′). PCR amplifications were performed with KOD plus polymerase as described before39 (link). The PCR product was purified using Wizard PCR Preps DNA Purification System (Promega, Madison, WI, USA). Purified double-stranded PCR fragments were directly sequenced with Big Dye Terminator Cycle sequencing kits (Applied Biosystems, Forster City, CA, USA).
5
Bacterial Identification through 16S rRNA Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pocket tissues and the samples obtained from generators surface were washed with phosphate buffer solution (PBS) and genomic DNA was extracted using Wizard genomic DNA extraction kit (Promega, USA) according to the manufacturer's protocol.
In order to accurately determine the bacteria in the sample, universal primers (upstream primer: AGAGTTTGATCCTGGCTCAG; downstream primer: AGTAAGGAGGTGATCCAACCGCA) were designed to target the conserved region of the 16S rRNA gene (rDNA) according to Escherichia coli (GenBank J01695), which could amplify nearly all bacteria by PCR (7700, Perkin Elmer, USA). The positive band indicated the presence of bacteria in the sample. The PCR product was purified using Wizard PCR Preps DNA Purification System (Promega) and then ligated into the pGEM-T Easy Vector (Promega). The ligation product was transformed into the E. coli strain JM109. Colonies containing the inserted 16S rRNA gene inserts were identified using blue/white screening. Plasmid DNA from candidate colonies was extracted and restricted with EcoRI. The inserted 16S rRNA gene sequence was then sequenced and identified by the BLAST algorithm against EMBL and GenBank databases.
In order to accurately determine the bacteria in the sample, universal primers (upstream primer: AGAGTTTGATCCTGGCTCAG; downstream primer: AGTAAGGAGGTGATCCAACCGCA) were designed to target the conserved region of the 16S rRNA gene (rDNA) according to Escherichia coli (GenBank J01695), which could amplify nearly all bacteria by PCR (7700, Perkin Elmer, USA). The positive band indicated the presence of bacteria in the sample. The PCR product was purified using Wizard PCR Preps DNA Purification System (Promega) and then ligated into the pGEM-T Easy Vector (Promega). The ligation product was transformed into the E. coli strain JM109. Colonies containing the inserted 16S rRNA gene inserts were identified using blue/white screening. Plasmid DNA from candidate colonies was extracted and restricted with EcoRI. The inserted 16S rRNA gene sequence was then sequenced and identified by the BLAST algorithm against EMBL and GenBank databases.
6
Differential Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SSH was performed with the PCR-Select™ cDNA subtraction kit (Clontech Laboratories, Inc., Mountain View, CA, USA) according to the manufacturer’s instructions. In brief, 2.0 μg of poly A+ mRNA, each from the pcDNA3.1(−)-MHBst167 tester group and the pcDNA3.1(−) driver group was subjected to cDNA synthesis, respectively. Following restriction with RsaI, small sizes of cDNAs were obtained. The tester cDNAs were then subdivided into two parts, ligated with the specific adaptor 1 and adaptor 2, respectively. After two subtractive hybridization reactions and two suppression PCR amplifications, differentially expressed cDNAs were selectively amplified. Subsequently, the second PCR products were used as templates for PCR amplification of G3PDH (a housekeeping gene) at 18, 23, 28, 33 cycles, respectively, to analyze subtraction efficiency. The second PCR products were directly purified using the Wizard® PCR-Preps DNA Purification system (Promega), and inserted into pGEM-T Easy (Promega) to construct the subtracted library. Colony PCRs were conducted to confirm that the size of the cDNA inserts ranged between 200 and 1,000 bp by using T7/SP6 specific primers localized in pGEM-T Easy. Following DNA sequencing of the positive colonies, nucleotide homology searches were performed using the BLAST program at NCBI (http://blast.st-va.ncbi.nlm.nih.gov/Blast.cgi ).
7
Borehole Microbial Community Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Borehole waters were first flushed with three to five section volumes of water. Planktonic cells >0.22 μm and >0.1 μm were collected on membrane filters and DNA extracted using the MO BIO PowerWater DNA isolation kit as described in Supplementary Files 1 and 2 . The cells passing the 0.22 μm filter (that is, the <0.22 μm fraction) were prepared by the iron chloride precipitation method followed by filtration through a 0.8 μm filter based on John et al. (2011) (link). The cells were concentrated with an Amicon Ultra-15 centrifugal device and DNA extracted with the Wizard PCR Preps DNA purification System (Promega, Fitchburg, WI, USA) (Supplementary Files 1 and 2 ). The 16S rRNA gene tag sequencing was carried out on an Illumina MiSeq(Illumina, San Diego, CA, USA), whereas community DNA was sequenced on an Illumina MiSeq and HiSeq from the >0.22 μm and <0.22 μm borehole fractions, respectively.
8
Molecular Barcoding of Ethanol-Preserved Specimens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 40 collected specimens were sequenced to obtain a molecular barcode. Genomic DNA was extracted from ethanol-preserved samples using the PowerSoil DNA extraction kit (MoBio, Carlsbad, CA, USA), following the manufacturer’s protocol. The oligonucleotide primers SP635F and SP1411R were used to amplify a portion of the 28S ribosomal subunit (Thacker et al., 2013 (link)), yielding an approximately 650bp fragment. PCR reaction products were gel-purified and cleaned using the Wizard PCR Preps DNA Purification System (Promega, Madison, WI, USA). Forward and reverse sequencing reactions were performed at the University of Alabama at Birmingham (UAB) Center for AIDS Research (CFAR) DNA Sequencing Core Facility. Forward and reverse sequences were then compared to ensure the accuracy of sequencing reactions in CodonCode Aligner software (CodonCode, Dedham, MA, USA) and Geneious (version 6.1.8; Biomatters Limited, Auckland, New Zealand), yielding a final consensus sequence for each voucher specimen. A representative sequence for each species is archived in GenBank under accession numbers KU746954 , KU746955 , KU746956 , KU746957 , KU746958 , KU746959 , KU746960 and KU746961 .
9
SSH Subtraction Library Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SSH was performed with the PCR-SelectTM cDNA subtraction kit (Clontech) according to the manufacture's protocol. In brief, 2.0 μg of poly A+ mRNA, each from the pcDNA3.1 (-)/myc-His A-HBVDNAPTP1 driver group and the pcDNA3.1 (-)/myc-His A tester group was subjected to cDNA synthesis, respectively. After restriction with RsaI, small sizes of cDNAs were obtained. The tester cDNAs were then subdivided into two parts, ligated with the specific adaptor 1 and adaptor 2, respectively. After two subtractive hybridization reactions and two suppression PCR amplifications, differentially expressed cDNAs were selectively amplified. Then the second PCR products were used as templates for PCR amplification of G3PDH (a housekeeping gene) at 18, 23, 28, 33 cycles, respectively, to analyze subtraction efficiency. The second PCR products were directly purified using Wizard PCR-Preps DNA Purification System (Promega), and inserted into pGEM-T Easy (Promega) to construct the subtracted library. Colony PCRs were conducted to confirm the size of cDNA inserts being ranged between 200 and 1000 bp by using T7/SP6 specific primers localized in pGEM-T Easy. After DNA sequencing of the positive colonies, nucleotide homology searches were performed using the BLAST program at NCBI.
10
Molecular Marker Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from silica gel-dried or fresh leaves using the method of Doyle and Doyle (1987) . Primers ITS4 and ITS5 (White et al. 1990 ) were used to amplify the ITS region followed the protocol of Li et al. (2010) (link). The rps16 intron was amplified with primers rpsF and rpsR2 (Oxelman et al. 1997 ) in accordance with the protocol of Marazzi et al. (2006) (link). The intergenic spacer trnH-psbA was amplified using the primers trnH (GUG) F and psbAR (Hamilton 1999 (link)). The PCR programme was as follows: 94 °C for 4 min; 30 cycles of 94 °C for 30 s, 52 °C for 30 s, 72 °C for 1 min; and 72 °C for 7 min. The rbcL was amplified with primers rbcL N' and DBRBAS2 (Terachi et al. 1987 ) for 26 sequences. The matK was amplified with primers 3F_KIM and IR_KIM (Kim, unpublished). Their PCR parameters were same as follows: 94 °C for 4 min; 30 cycles of 94 °C for 1 min, 52 °C for 1 min, 72 °C for 1 min 30 s; and 72 °C for 10 min. PCR products were separated using 1.5 % (w/v) agarose TAE gel and purified using Wizard PCR preps DNA Purification System (Promega, Madison, WI, USA) following the manufacturer’s instructions. The purified PCR products were sequenced in an ABI 310 Genetic Analyzer (Applied Biosystems Inc.) using the PCR primers.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!