Relative copy numbers of the integrated gRNA were determined by qPCR. Genomic DNA was extracted using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific) according to manufacturer instructions. qPCR was run on a QuantStudio 5 Real-Time PCR System (Agilent Technologies). Amplification was performed under the following conditions: 50°C for 2 min, 95°C for 10 min; 40x: 95°C for 15 s, 60°C for 1 min. Copy numbers of gRNA were determined with C1GALT1C1 as an internal control gene for normalization using SYBR Green qPCR kit (Thermo Fisher Scientific). Forward primer 5′-GCAGCCTTTCTATCTAGGACAC-3′ and reverse primer 5′-CCACCTTGTTCAGGACACTT-3′ are designed for C1GALT1C1 detection. Forward primer 5′-GCTTTATATATCTTGTGGAAAGGACGAAACACC-3′ and reverse primer 5′-CCGACTCGGTGCCACTTTTTCAA-3′ are designed for gRNA detection. Primer pairs were validated by melting curve analysis and primer efficiency test. A delta-delta threshold cycle (ΔΔCt) method was applied to calculate the copy number of gRNA integrated using previously single-copy calibrators. Each experiment was performed in technical triplicates using genomic DNA from CHO-S cells as a negative control.
Quantstudio 5 real time pcr system
Manufactured by Agilent Technologies
The QuantStudio 5 Real-Time PCR System is a high-performance real-time PCR instrument designed for accurate and reliable gene expression analysis, genotyping, copy number variation, and microRNA studies. The system features a 96-well block and supports a wide range of sample volumes and reaction formats, providing flexibility for diverse experimental needs.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green qpcr kit, by Thermo Fisher Scientific (3 mentions)
Genejet genomic dna purification kit, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr kit, by Takara Bio (2 mentions)
Mirna rt kit, by Takara Bio (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Trizol kit, by Takara Bio (1 mentions)
5 protocols using quantstudio 5 real time pcr system
1
Quantifying CRISPR gRNA Copy Number
2
Quantifying CRISPR gRNA Copy Number
3
Quantitative Analysis of CRISPR gRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative copy numbers of the integrated gRNA were determined by qPCR. Genomic DNA was extracted using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific) according to manufacturer instructions. qPCR was run on a QuantStudio 5 Real-Time PCR System (Agilent Technologies). Amplification was performed under the following conditions: 50 C for 2 min, 95 C for 10 min; 40x: 95 C for 15 s, 60 C for 1 min. Copy numbers of gRNA were determined with C1GALT1C1 as an internal control gene for normalization using SYBR Green qPCR kit (Thermo Fisher Scientific). Forward primer 5 0 -GCAGCCTTTCTATCTAGGACAC-3 0 and reverse primer 5 0 -CCACCTTGTTCAGGACACTT-3 0 are designed for C1GALT1C1 detection. Forward primer 5 0 -GCTTTATATATCTTGTG GAAAGGACGAAACACC-3 0 and reverse primer 5 0 -CCGACTCGGTGCCACTTTTTCAA-3 0 are designed for gRNA detection. Primer pairs were validated by melting curve analysis and primer efficiency test. A delta-delta threshold cycle (DDCt) method was applied to calculate the copy number of gRNA integrated using previously single-copy calibrators. Each experiment was performed in technical triplicates using genomic DNA from CHO-S cells as a negative control.
4
miRNA Quantification via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from TTS and normal control tissues. In addition, an miRNA RT kit (Takara, China) was used for the RT of total RNAs into cDNAs. Next, qRT-PCR was carried out using the QuantStudioTM 5 Real-Time PCR System (Agilent Technologies) by use of SYBR Green PCR Kit (Takara), following the protocol of the manufacturer. Sangon Biotech (Shanghai, China) was utilized for the chemical synthesis of primers used for qRT-PCR. Table 1 shows the sequences of these primers. U6 was used as the internal reference, and 2-△△CT was used as the relative expression level.
5
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Trizol kit (Takara, China) was employed to extract the total RNA from cells or tissues. A reverse transcription kit (Takara) was applied to synthesize complementary DNAs (cDNAs). Quantitative real-time polymerase chain reaction (qRT‑PCR) was conducted by the QuantStudioTM 5 Real-Time PCR System (Agilent Technologies) using the SYBR Green PCR Kit (Takara) as per the protocol of the manufacturer. U6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were taken as the internal references for miRNAs and mRNAs respectively. Additionally, 2-△△CT was used as the relative expression level. Sangon Biotech (Shanghai, China) was employed to chemically synthesize primers whose sequences are presented in Table 2 .
Primer sequences for qRT-PCR
| Gene name | Sequences |
|---|---|
| MiR-34c-5p-Forward | CGAGTGTAGTTAGCTGATTGCAAA |
| U6-Forward | GGAACGATACAGAGAAGATTAGC |
| U6-Reverse | TGGAACGCTTCACGAATTTGCG |
| MDMX-Forward | CTTCTCCGTGAAAGACCCAAGCC |
| MDMX-Reverse | TCCTGTGCGAGAGCGAGAGTC |
| Notch1-F | AAGAGTGCACCCATGGTACCAA |
| Notch1-R | TGACATGCATGATGCCTACATTTC |
| GAPDH-Forward | CTTTGGTATCGTGGAAGGACTC |
| GAPDH-Reverse | GTAGAGGCAGGGATGATGTTCT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!