Peasy t vector

The human wild-type and mutant ZFPM2 sequences were cloned into the pEasy-T vector (Promega, USA). The capped and poly(A) tailed mRNA of hZFPM2 and its mutant were synthesized in vitro by transcribing with T7 RNA polymerase using the mMessageMachine T7 Ultra Kit (Ambion, Cat #AM1345, USA). The embryos of the transgenic cmlc2 were as follows: eGFP was collected for the microinjection at the single-cell stage. The experimental groups included the Mut, WT and control groups. For the control group, an equal volume of solution was injected. One hundred embryos were collected from each injection group and the control group. The purified mRNA of 450 pg was injected into the embryos at the single-cell stage. A minimum of three independent experiments was performed for the wild-type and mutant ZFPM2 mRNA injections.

The expression of smyd4 was detected in zebrafish embryos from the 10 to 72 hpf stages using a smyd4-specific antisense probe. The template for the smyd4 probe was amplified from the cDNA of zebrafish at 24 hpf. The 508-bp fragment, which was obtained using specific primers (smyd4-probe-F: GAAGTGTGTGAAATGTGGAAAGCCTCTT and smyd4-probe-R: TTCACTCAGTTCCTGCAGTTCTTCACAG), was cloned into the pEasy-T vector (Promega, USA). After linearization of the plasmids, the antisense and sense probes were transcribed and labelled with digoxigenin in vitro. RNA in situ hybridization was performed as described previously [33 (link)]. Briefly, zebrafish embryos at different stages were collected and fixed in 4% paraformaldehyde at 4°C overnight. Embryos older than 24 hpf were digested by proteinase K at room temperature. Then, the embryos were pro-hybridized at 65°C for 4 hours and subsequently incubated with the antisense or sense probes overnight. An anti-digoxigenin antibody (Roche, USA) was used to bind the probes overnight at 4°C. Finally, the embryos were stained with NBT/BCIP (Vector, USA) and photographed in methylcellulose using a Leica M205C microscope.