Geneamp rna pcr kit

Total RNA was converted to cDNA using a GeneAmp^® RNA-PCR kit (Applied Biosystems, CA, USA). The cDNAs were then used for quantitative PCR analysis with SYBR^® Premix Ex Taq (TaKaRa, Otsu, Japan). Oligonucleotide primers specific for KIAA1199 (forward: 5′-CAGCTGGCTCACTCTGACCT-3′ and reverse: 5′-TCTTTAATGACCAGCTTGCC-3′) were purchased from Sigma Aldrich. The PCR was performed using Thermal Cycler Dice (TaKaRa) under the following conditions: 95°C for 5 min, 50 cycles of 95°C for 5 s, plus 60°C for 10 s. GAPDH was used as an internal control to normalize and compare each sample.

Total RNA isolated from pulverized skin (NucleoSpin RNA extraction kit, Macherey-Nagel) was used for cDNA synthesis (GeneAmp RNA PCR kit, Applied Biosystems). Quantitative PCR amplification reactions were performed in the 7500 Fast Real-Time PCR System (Applied Biosystems). TaqMan assays (Applied Biosystems) were used to quantify the mRNA expression of mouse TREX2 (Mm04210320_m1), TNFα(Mm00443258_m1), IL6 (Mm00446190_m1), IL1β (Mm00434228_m1), IL1α (Mm00439620_m1), IL10 (Mm00439616_m1), IFNγ (Mm00801778_m1), CXCL10 (Mm00445235_m1), CCL5 (Mm01302427_m1), TGFβ (Mm00441724_m1), Mx1 (Mm00487796_m1), Camp (Mm00438285_m1), IFNβ (Mm00439552_s1), IFNα (Mm03030145_gH) and SDHA (Mm01352366_m1). The following primers were used to quantify mRNA expression: mouse L12α (Forward (F), 5′GTACCAGACAGAGTTCCAGG; Reverse (R), 5′CGCAGAGTCTCGCCATTATG), IFNκ (F, 5′CTGACAGTCTACCTGGAGTTG; R, 5′GTTCTTGCTTGAAGGTGGGTG), iNOS (F, 5′CTCGGAGGTTCACCTCACTG; R, 5′GTGCTGCAGACACCATGGTG), IRF7 (F, 5′GAGCAAGACCGTGTTTACG; R, 5′CATGATGGTCACATCCAGG), and Raet1e (F, 5′AGCAGTGACCAAGCGCCATC; R, 5′CCTTGATGGTCAAGTTGCAC). Samples prepared without reverse transcription enzyme served as negative control templates. Values were normalized to SDHA expression because of its suitability as a reference gene in UVB-irradiated keratinocytes [59 (link)] and data were expressed as arbitrary units.

RNA was extracted from purified lymph node CD8⁺T cells after 24-h anti-CD3 activation using RNeasy Plus kit (Qiagen) and retrotranscribed with MuLV from the GeneAmp RNA PCR kit (Applied Biosystems). This cDNA was used as template for the cloning PCR using the high fidelity proof reading Pfu Turbo Polymerase (Stratagen) with the cloning primers (see Additional file 3: Materials). The purified PCR product was subcloned in a passenger pCR®-Blunt II TOPO® vector (ThermoFisher Scientific) and sequenced. This passenger vector was further restricted with MfeI and SnaBI enzymes (New England Biolabs) and cloned into pMiev retrovirus vector. PlatE virus packaging cells were transfected with pMiev (empty or Ccnd1 4–5) in presence of lipofectamin LTX (Invitrogen). Media was changed at 24 h and supernatant harvested two days after, filtered onto 0.45 μ and used to transduce purified LSK.

Total RNA was extracted using Trizol reagent (Life Technologies) according to manufacturer's protocol. One microgram of RNA was used for cDNA synthesis using GeneAmp RNA PCR Kit (Applied Biosystems, Life Technologies). Gene expression was examined by Power SYBR^® Green PCR Master Mix (Applied Biosystems, Life Technologies) using the primers indicated in (Supplementary Table S3) with Applied Biosystems 7900HT Fast Real-Time PCR System. Target gene expressions were normalized with 18s rRNA level.

Total RNA isolated from cells [NucleoSpin RNA extraction kit, Macherey-Nagel] was used for cDNA synthesis [GeneAmp RNA PCR kit, Applied Biosystems]. Quantitative PCR amplification reactions were performed in the 7500 Fast Real-Time PCR System [Applied Biosystems] using TaqMan Gene Expression Master Mix. Values were normalized to Sdha. The following TaqMan assays [Applied Biosystems] were used to quantify mRNA expression of mouse Sdha (Mm01352366_m1), Il-1β (Mm00434228_m1), Il-1α (Mm00439620_m1), Mpo (Mm01298424_m1) and Tnfα (Mm00443258_m1). The following primers were used to quantify mRNA expression: Il-6 (Forward (F), AGTTGCCTTCTTGGGACTGA; Reverse (R), TCCACGATTTCCCAGAGAAC), IL-12a (F, GTACCAGACAGAGTTCCAGG; R, CGCAGAGTCTCGCCATTATG), IL-18 (F, CTACCCTCTCCTGTAAGAAC; R, CTTGTTGTGTCCTGGAACAC), IL-23a (F, CAAGGACTCAAGGACAACAG; R, GGTGTGAAGTTGCTCCATG), NFKbia (F, AACCTGCAGCAGACTCCACT; R, GACACGTGTGGCCATTGTAG), Trp53 (F, CACAACTGCACAGGGCAC; R, CATGGAGGAGTCACAGTCGG).