Pcr thermocycler

DNA monomer stock solutions (2 μM) were prepared in 45 mM Tris (pH 8.0), 20 mM MgCl₂. For a typical experiment, complementary DNA monomers (monomers 1 and 2 with the same spacer designs) were combined in equal volume to obtain a final concentration of 1 μM per monomer. The linear dimer control reactions were performed by combining monomers 1 and 2_ctrl of the same spacers. The combined fractions were subject to a slow-cool gradient (90° to 25°C, 0.1°C/min) using a polymerase chain reaction (PCR) thermocycler (Applied Biosystems) or allowed to react overnight (15 hours) under room temperature (22°C).

Total RNA was extracted using TRIzol reagent (Invitrogen Inc., Carlsbad, CA, USA). Semi-quantitative RT-PCR was conducted using 2 × EasyTaq PCR SuperMix (TransGen Biotech, Beijing, China) in a PCR thermocycler (Applied Biosystems, Life Technologies, Melbourne, Australia). The primers were as follows: 5-α reductase type 1 (SRD5A1), 5'- GAAACTTGCCAACCTTCGTG -3' (forward), and 5'- CTTACTCCGTATGAACCACCA -3' (reverse); SRD5A2, 5'- CTCTTCTGCCTACATTACTTCCA -3' (forward) and 5'- CACCCAAGCTAAA CCGTATGTC -3' (reverse); and DNMT1, 5'- GCAAACCACCATCACATCTC -3' (forward) and 5'- GTAACTCTACGTCTCTTCTCATCC -3' (reverse). The reactions were predenatured at 94°C for 5 min, followed by 35 cycles of PCR with denaturing at 94°C for 30 s; annealing at 55°C, 54°C, or 57°C, respectively, for 30 s; and extension at 72°C for 1 min, with a final extension at 72°C for 10 min. The PCR products were subjected to electrophoresis in 1.5% agarose gels, stained with ethidium bromide, and photographed.

The promoter region of the ADFP gene was amplified from human genomic DNA using polymerase chain reaction (PCR) and cloned into a luciferase reporter vector (pGL3-Basic; Promega Corporation, Madison, WI, USA). Briefly, human genomic DNA was extracted using a Quick Genomic DNA Extraction kit (Guangzhou Dongsheng Biotech Co., Ltd., Guangzhou, China) according to manufacturer's instructions. A total of 50 ng genomic DNA was then used as a template to amplify the promoter region of the ADFP gene in 20 µl reaction system containing 1 µl of 10 µM primers (Sangon Biotech Co., Ltd. Shanghai, China), 1 µl of 25 µM dNTP mixture (Beijing TransGen Biotech Co., Ltd., Beijing, China) and 1 µl DNA polymerase (Beijing TransGen Biotech Co., Ltd.). The following primer sequences were used: ADFP, forward 5′-agacgcgtCATGCCTGGCTATTTAGTG-3′ and reverse 5′-ccctcgagCTCATGCCGGTAATCCCAGCA-3′. The PCR reaction was performed in a PCR Thermocycler (Thermo Fisher Scientific, Inc.) with the following reaction conditions: 95°C for 5 min, followed by 40 cycles of 95°C for 30 sec, 60°C for 30 sec and 72°C for 1 min. As a positive control, the nucleotide sequence containing the identified HRE of the erythropoietin (EPO) gene (14 (link)) was also cloned into the pGL3-promoter.

The chemicals and reagents utilized in this work were acquired from Merck (Germany) and Sigma (USA). Primers were manufactured from Gene LinkTM (USA) through World Wide Scientific Corp, Lahore, Pakistan. InsTAclone PCR cloning kit, QIAquick Gel Extraction kit, Plasmid isolation kit (Expin plasmid SV Mini, 50p) by GeneAll was used, restriction enzymes, T4 DNA ligase, DNA ladder, ColorPlus prestained protein marker, extensive ranging from (10–180 kDa) and Protino® Ni-TED kit were obtained from Thermo Fisher Scientific. Plant biomass (sugarcane bagasse & wheat straw) were collected from the fields of Lahore, Pakistan. PCR thermocycler (Applied Biosystem, Veriti, UK), rotatory shaking incubator (Ecocell). UV-spectrophotometer (Cecil-CE7200.0, Aquarius, UK) and SEM analysis was performed by MAIA3 TESCAN (Bartin University, Turkey). Other chemicals used in this work were of analytical grade.