Pac gfpc1 sec61β

For the fluorescent labeling of organelles and subcellular compartments, ER localization was achieved by fusing Sec61β to the C-terminus of FPs and insertion into pcDNA3.0 between BamHI and EcoRI restriction sites using In-Fusion cloning (Takara Bio). Sec61β fragment was obtained from pAc-GFPC1-Sec61β (Addgene #15108). For labeling focal adhesion sites, emiRFP703 between AgeI and NotI restriction sites in pzyxin-emiRFP703 (Addgene #136568) was swapped with Rep-miRFP. For labeling clathrin-coated vesicles, Kohinoor between NheI and BglII restriction sites in Kohinoor-Clathrin (Addgene #67773) was swapped with Rep-miRFP. For labeling the nucleus, Phamret between BamHI and EcoRI restriction sites in Phamret-H2B (Addgene #51955) was swapped with SPOON or miRFP720. For bicistronic expression of sfGFP and NIR FPs, the two domains were linked by a self-cleaving P2A peptide and inserted into pcDNA3.0 between BamHI and EcoRI restriction sites.

The following expression vectors were used; pECFP-N1-Golgi (Clonotech Laboratories, Inc); pAcGFP-C1-Sec61β (Addgene, Cambridge, MA); vectors expressing Y890F and Y890E variants of β-DG were generated using a QuickChange Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions with a full length α-/β-dystroglycan-GFP construct^{45 (link)} as template. Forward and reverse primers for the Y890F mutation were CACCCCCTCCGTTTGTTCCCCCTGCC and GGCAGGGGGAACAAACGGAGGGGGTG, and for the Y890E mutation were CGATCACCCCCTCCGGAAGTTCCCCCTGCCCC and GGGGCAGGGGGAACTTCCGGAGGGGGTGATCG respectively. Cells were transfected with the appropriate vector using lipofectamine 2000 (Invitrogen, Carlsbad, California, USA) following the provider’s protocol, and further analyzed at 24 h post-transfection. Lysates from C2C12 cells expressing GFP-tagged proteins were precipitated using the GFP-Trap® system (Chromotek, Germany) following the manufacturer’s instructions.