Strand cdna synthesis kit

RT-PCR was used to quantify gene expression. Total RNA (mRNA) was extracted from articular chondrocytes using the total RNA extraction kit (Toyobo, Japan) following the manufacturer's instructions. RNA concentration and purity were assessed using a Microvolume Spectrophotometer (Thermo Fisher Scientific, Logan, UT, USA). Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using first Strand cDNA Synthesis Kit (Toyobo, Osaka, Japan). Then the cDNA was amplified by SYBR Green Real-time PCR Master Mix (Toyobo, Osaka, Japan) with following cycling conditions: 30 s of polymerase activation at 95°C, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. GAPDH was used as an internal control. Each cDNA sample was run in triplicate. Sequences of primers for the reference gene (GAPDH) and interested genes are listed as follows: DMT1, Forward: 5′-TCTTCGGTTCCTCTCACTCCTGTG-3′, Reverse:5′-AGAGCCTGCCACCACCAGTC-3′; TFR1, Forward:5′-AATGGTTCGTACAGCAGCGGAAG-3′, Reverse:5′-TAGCACGGAAGTAGTCTCCACGAG-3′; FPN, Forward:5′-GCCTCTGCCTCTGCCTCTACC-3′, Reverse: 5′-AGTCAGTCCACGAGTGCTACAGTC-3′; GAPDH:Forward:5′-CTCCCACTCTTCCACCTTCG-3′, Reverse:5′-TTGCTGTAGCCGTATTCATT-3′

Total mRNA expression was extracted with the total RNA extraction kit (Toyobo, Japan) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from total RNA using first Strand cDNA Synthesis Kit (Toyobo, Japan). Then the cDNA was amplified with SYBR Green Real-time PCR Master Mix (Toyobo, Japan) with the following cycling conditions: 30 s of polymerase activation at 95°C, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was selected as the internal control. Each cDNA sample was run in triplicates. Sequences of primers used were listed as follows: RUNX2: forward (CCCAGCCACCTTTACCTACA), reverse (ATGGAGTGCTGCTGCTGGTCTG); OPN: forward (GCGCTCTGTCTCTCTGACCT), reverse (ACCTTATTGCCCTCCTGCTT); GAPDH:forward (AACATCAAATGGGGTGAGGCC), reverse (GTTGTCATGGATGACCTTGGC).