Miscript transcription kit

Total RNA samples were isolated from cells and amnion tissues using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Five micrograms of RNA was used for cDNA synthesis using the Maxime RT PreMix Kit (iNtRON Biotechnology, Seoul, South Korea). PCR reactions were performed using a 2× Rotor-Gene SYBR Green PCR Master Mix (Qiagen, Carlsbad, CA, USA) in the Rotor-Gene Q (Qiagen). The primers used were HMGB1 (forward): 5′-ACATCCAAAATCTTGATCAGTTA-3′ and (reverse) -3′ (reverse) 5′-CTCCTTAATGTC ACGCACGA-3′; and Actin (forward): 5′-CATGTACGTTGCTA TCCAGGC-3′ (reverse) 5′-CTCCTTAATGTCACGCACGA-3′. For the analysis of miRNA expression, miRNAs were isolated from the hAECs and amnion tissues using miRNeasy (Qiagen), followed by reverse transcription with the miScript Transcription Kit (Qiagen). The miRNA expression level was measured with a miScript SYBR Green PCR Kit (Qiagen) using the Rotor-Gene Q (Qiagen). Primers for miRNAs and endogenous control U6 gene are shown in Table 4.Table 4

Sequences of the primers used in real-time RT-PCR.

Designation	Sequence (5′ → 3′)
miR-548aa	AAAAACCACAATTACTTTTGCACCA
miR-548ai	AAAGGTAATTGCAGTTTTTCCC
miR-548a-3p	CAAAACTGGCAATTACTTTTGC
miR-548x-5p	TGCAAAAGTAATTGCAGTTTTTG
U6	CTCGCTTCGGCAGCACA

Total RNA samples were extracted from Met5A and mPMCs using the easy-Blue reagent (iNtRON Biotechnology, Seoul, Korea). Strand cDNA was synthesized using the Maxime RT PreMix Kit (iNtRON Biotechnology). Total miRNA was extracted from frozen mouse lung tissue and Met5A or mPMCs using miRNeasy Mini Kit (Qiagen, Germantown, MD, USA), followed by reverse transcription using the miScript Transcription Kit (Qiagen). For quantitative RT-PCR (qRT-PCR), the SYBR Green PCR Kit (Qiagen) was used in Rotor-Gene Q (Qiagen). The primer sequences used for qRT-PCR are shown in Table 1 and Table 2.

The total number of RNA was isolated from the cells by using TRIzol (Life Technologies, USA) according to the manufacturer's instructions. The quality and concentration of RNA were evaluated by using NanoDrop (Thermo Scientific, USA). The miRNAs were reversely transcribed into cDNA by using the miScript transcription kit (Qiagen, Germany) according to the manufacturer's instructions. For the measurement of mRNA, cDNA was synthesized by using the PrimeScript RT reagent kit (Takara, China) according to the manufacturer's guidelines. The expressions of miR-15b-5p and GLS2 were quantified by using the SYBR Green PCR Master Mix Kit (Bio-Rad Laboratories, USA). The relative levels of miR-15b-5p and GLS2 were normalized to U6 and GAPDH, respectively. The calculation was carried out using the 2^−ΔΔCq method, and the experiments were repeated three times.