Rnapii

Manufactured by Merck Group

Sourced in United States

RNAPII is a core component of the RNA polymerase II complex, which is responsible for the transcription of protein-coding genes in eukaryotic cells. It plays a crucial role in the synthesis of messenger RNA (mRNA) from DNA templates.

Automatically generated - may contain errors

Lab products found in correlation

Gapdh, by Thermo Fisher Scientific (1 mentions) Ser2 rnapii, by Abcam (1 mentions) Hsp90, by Cell Signaling Technology (1 mentions) Hdac1, by Active Motif (1 mentions) Chip it kit, by Active Motif (1 mentions) β catenin, by Cell Signaling Technology (1 mentions) Runx2, by Cell Signaling Technology (1 mentions) Enhanced chemiluminescence detection system, by Cytiva (1 mentions) α tubulin, by Abcam (1 mentions) Topoisomerase 1, by Abcam (1 mentions) Igfii, by Abcam (1 mentions) Nitrocellulose membrane, by Bio-Rad (1 mentions) Gapdh, by Abcam (1 mentions) Image pro plus software, by Media Cybernetics (1 mentions) Cyclin t1, by Santa Cruz Biotechnology (1 mentions) Srsf1, by Santa Cruz Biotechnology (1 mentions)

4 protocols using rnapii

Subcellular Fractionation Using REAP Method

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Subcellular fractionation was performed using the REAP method with the minor modification of using one 10-cm plate for each fractionation condition [43 (link)].
Cell lysates were prepared with lysis buffer (50 mM Tris [pH 7.6], 150 mM NaCl, 0.5% NP-40) and quantified by Bradford assay. Equivalent amounts of each sample were resolved by SDS-PAGE, electrotransferred to PVDF membrane, and blotted for the indicated proteins. Antibodies: FUS (Santa Cruz; diluted 1:5000), GAPDH (Invitrogen; diluted 1:5000), H3 (Millipore, Burlington, MA, USA; diluted 1:1000), Hsp90 (Cell Signaling, Danvers, MA, USA; diluted 1:1000), RNAPII (Millipore; 1:1000), Ser2 RNAPII (Abcam; diluted 1:1000), RTA (diluted 1:10,000), ORF57 (diluted 1:1000), and bZIP (diluted 1:2000). Primary antibodies were followed by AlexaFluor 680-conjugated anti-rabbit and anti-mouse secondary antibodies (Life Technologies, Carlsbad, CA, USA; 1:5000) and visualized by Li-Cor Odyssey.

Dunker W., Song Y., Zhao Y, & Karijolich J. (2018). FUS Negatively Regulates Kaposi’s Sarcoma-Associated Herpesvirus Gene Expression. Viruses, 10(7), 359.

+ Open protocol

+ Expand

ChIP-seq Analysis of Transcription Factors

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

MC3T3 cells were transfected with siRNA and/or stimulated with TNFα (10 ng/mL) for 1 hour. ChIP assays were performed using ChIP-IT kit (Active Motif, Carlsbad, CA, USA).^{(39 (link))} Isolated DNA was subjected to real-time PCR using specific primers from IDT.
For some of the experimental studies, the cells were washed and incubated with Wnt3a (100 ng/mL) or Bmp2 (100 ng/mL) for 4 hours. About 45 minutes before stimulation, some of the cells were incubated with TNFα (10 ng/mL). After stimulation, protein synthesis was inhibited by incubating the cells with cycloheximide for 3 hours, after which ChIP assay was carried out. The chromatin was immunoprecipitated using antibodies for p65 (Active Motif), p50 (Cell Signaling Technology), HDAC1 (Active Motif), β-catenin (Cell Signaling Technology), Runx2 (Cell Signaling Technology), or RNAP-II (Millipore, Billerica, MA, USA) using the manufacturer’s recommendations.

Tarapore R.S., Lim J., Tian C., Pacios S., Xiao W., Reid D., Guan H., Mattos M., Yu B., Wang C.Y, & Graves D.T. (2015). NF-κB Has a Direct Role in Inhibiting Bmp- and Wnt-Induced Matrix Protein Expression. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(1), 52-64.

+ Open protocol

+ Expand

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total protein from the human HCC cell lines was extracted using RIPA buffer (Pierce, Rockford, IL, USA). Equal amounts of protein for each sample were subjected to SDS-PAGE followed by transfer of protein to nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). The membranes were first incubated with antibodies against IGF-II (Abcam, Cambridge, UK), Ago1 (Millipore, Billerica, MA, USA), Ago2 (Millipore), RNAP II (Millipore), α-tubulin (Abcam), Topoisomerase I (Abcam), and GAPDH (Abcam), then followed by incubation with HRP-conjugated secondary antibodies. GAPDH (Abcam) was served as a loading control. The results were visualized using an enhanced chemiluminescence detection system (Amersham Biosciences, Piscataway, NJ, USA). Bands were quantified with Image-Pro Plus software (Media Cybernetics, USA). Each experiment was repeated thrice and all reactions were carried out in triplicate.

Tang S., Chen Y., Feng S., Yi T., Liu X., Li Q., Liu Z., Zhu C., Hu J., Yu X., Wang M., Cao G., Tang H., Bie C., Ma F., Tang H., Du G, & Huang J. (2017). MiR-483-5p promotes IGF-II transcription and is associated with poor prognosis of hepatocellular carcinoma. Oncotarget, 8(59), 99871-99888.

+ Open protocol

+ Expand

ChIP-qPCR analysis of HIV-1 transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 cells transfected with the indicated plasmids. At 48 h post-transfection cells were cross-linked in 1% formaldehyde and ChIP was performed as previously described (22 (link)) utilizing the following antibodies RNAPII (Millipore, clone CTD4H8), RNAPII Phospho Ser2 (AbCam, #ab24758), GFP (Santa Cruz Biotechnology, #sc-9996), SRSF1, Cyclin T1 (Santa Cruz Biotechnology, sc-10750) or normal rabbit immunoglobulin G (IgG) (Cell Signaling Technologies, #2729). The green fluorescent protein (GFP) antibody was utilized to precipitate the product of the pTat-GFP construct. The data collected were derived from three independent experiments and quantified by qPCR assays carried out with primer pairs specific for the LTR promoter (TAR_Fb: GGAACCCACTGCTTAAGCCT; TAR_Rb: GGATCTCTAGTTACCAGAGT) and the open reading frame (ORF) (RF21.21: TTCTTCAGAGCAGACCAGAGC; RF20.22: GCTGCCAAAGAGTGATCTGA) utilizing a Stratagene Mx3005P and analyzed with MxPro V3.0 software. The data sets were normalized to input values and results expressed as fold enrichment over the IgG control. Data are represented as means ± SEM.

Paz S., Krainer A.R, & Caputi M. (2014). HIV-1 transcription is regulated by splicing factor SRSF1. Nucleic Acids Research, 42(22), 13812-13823.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!