Abi stepone software v2

RNA primers were designed and synthesized (Table S3 for primer sequences, synthesized by Sangon Biotech, Shanghai, Co., Ltd. China). Total cellular RNA was extracted using Trizol method. Then the purity and concentration of total RNA were tested. Reverse transcription was proceeded using Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, MA, USA) according to the Maxima SYBR Green qPCR Master Mix (2X) kit instructions (Thermo Fisher Scientific). The corresponding reaction system was added under dark condition, PCR amplification was implemented with β‐actin used as an internal reference, the experimental setup procedures were as follow: 95°C, 5 minutes; 95°C, 5 minutes; 40 cycles of reaction; 95°C,15 seconds; 60°C, 30 seconds, the results of the experiment were recorded after the cycles were completed. The results were analysed with ABI Step One Software V 2.1 software (Applied Biosystems, MA, USA), and the relative expression of genes was analysed by the formula 2−ΔΔCt.

Viral RNA was extracted using Qiamp Viral RNA Kit (Qiagen) for sera and swabs samples and Nucleospin Kit (Macherey Nagel) for PBMCs. Viral load was evaluated by one-step RT-qPCR (NEB Luna® Universal One-Step RT-qPCR kit) using MeV-N-specific primers (MeV-N FW: GTG ATC AAA GTG AGA ATG AGC and MeV-N Rev: GCT GAC CTT CGA CTG TCC T) and GAPDH primers if necessary (GAPDH FW: CACCCACTCCTCCACCTTTGAC, GAPDH REV: GTCCACCACCCTGTTGCTGTAG). PCR amplification was recorded on a Step One plus apparatus (Thermo). All samples were run in duplicates, and results were analyzed using the ABI StepOne software v2.1 (Applied Biosystems).

TRIzol reagent (Invitrogen, USA) was used to extract total RNA from tissues, cells and CM derived-exosomes, which were purified using a miRNeasy Serum/Plasma Kit (Qiagen, Germany; Cat. Number: 217184), as instructed by the manufacturer. In addition, exosomal RNA was isolated directly from serum, using an exoRNeasy Serum/Plasma MidiKit (Qiagen, Hilden, Germany; Cat. Number: 77044). The miRNeasy Serum/Plasma Spike-In Control (cel-miR-39, Qiagen, Hilden, Germany; Cat. Number: 219610) was used as the serum miRNA expression profiling internal control, as instructed by the manufacturer. The cDNA of the RNAs were created with the aid of a PrimeScript™ RT Reagent Kit (TaKaRa, Japan; Code No. RR037A (miRNAs)/RR036A (mRNAs)). TB Green® Premix Ex Taq™ (TaKaRa, Japan, Code No. RR420A) was used to conduct the qRT -PCR, with the results recorded using ABI StepOne™ Software v2.3 (Applied Biosystems, USA). GAPDH functioned as an internal control for DYNLT1 mRNA levels and the relative miR-15b-3p expression of serum-exosomes were normalized to cel-miR-39, which was normalized to U6 in CM-exosomes, cells and tissues. The 2^−ΔCT formula was used to determine gene expression fold change. Additional file 7: Table S1 lists all primary sequences used.