Log In Sign up
The largest database of trusted experimental protocols

Nontarget shrna

Manufactured by Merck Group
Visit Supplier
Sourced in United States, Japan

Nontarget shRNA is a laboratory tool designed for use in gene knockdown experiments. It is a short hairpin RNA (shRNA) sequence that does not target any known gene, serving as a control for off-target effects in RNA interference (RNAi) studies.

Automatically generated - may contain errors

Lab products found in correlation

Polybrene, by Merck Group (1 mentions) Bacterial glycerol stock, by Merck Group (1 mentions) Calcium phosphate transfection kit, by Thermo Fisher Scientific (1 mentions) Sybr green assay, by Bio-Rad (1 mentions) P24 elisa, by Cell Biolabs (1 mentions) Plasmid maxi kit, by Qiagen (1 mentions) Pmd2 g, by Addgene (1 mentions) Sureprint g3 human ge 60k microarray, by Agilent Technologies (1 mentions) Plko 1 empty vector, by Merck Group (1 mentions) Rad51 h 92, by Santa Cruz Biotechnology (1 mentions) Cdk2 m2, by Santa Cruz Biotechnology (1 mentions) Anti cyclin d1 h 295, by Santa Cruz Biotechnology (1 mentions) Cyclin a c 19, by Santa Cruz Biotechnology (1 mentions) Gst z 5, by Santa Cruz Biotechnology (1 mentions) Control sirna, by Qiagen (1 mentions) Pmission vsv g, by Merck Group (1 mentions) Pmissiongagpol, by Merck Group (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)

6 protocols using nontarget shrna

1

Rab27a Gene Expression Inhibition

Check if the same lab product or an alternative is used in the 5 most similar protocols
To inhibit Rab27a gene expression, a vector for short hairpin RNA (shRNA) incorporated in pLKO.1-puro (Sigma-Aldrich, Mission shRNA code: TRCN 0000005294) and a vector for shRNA control (Sigma-Aldrich, Non-Target shRNA) were transfected into HL60 cells by lentiviral system and positive clones were selected with 1 µg/ml puromycin.
Kawakami T., He J., Morita H., Yokoyama K., Kaji H., Tanaka C., Suemori S.I., Tohyama K, & Tohyama Y. (2014). Rab27a Is Essential for the Formation of Neutrophil Extracellular Traps (NETs) in Neutrophil-Like Differentiated HL60 Cells. PLoS ONE, 9(1), e84704.
+ Open protocol
+ Expand
2

IGF-I Silencing in Adipose Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Commercial available short hairpin RNA (shRNA) constructs were obtained as bacterial glycerol stocks (Sigma) and used to silence murine IGF-I. Plasmid DNA of shRNA and pLVX-Puro-HS-GR vector was purified using a plasmid extraction kit (Plasmid Maxi Kit, Qiagen). Lentiviral vector particles were produced by three plasmid cotransfection onto HEK 293T with 40 μg of shRNA or pLVX-Puro-HS-GR vector DNA, 30 μg pCMV-ΔR8.91 (The Broad Institute, MA, USA), and 10 μg pMD2.G (Addgene, clone 12259) using a calcium-phosphate transfection kit (Invitrogen). Lentiviral vector concentration was determined by p24 ELISA (Cell Biolabs). ASCs were transduced in passage 2 with 2.56 × 105 TU/mL virus and polybrene (8 μg/mL) (Chemicon). After 8 hours, the medium was replaced by fresh DMEM. Twenty-four hours later, antibiotic selection (1.3 μM puromycin) was initiated for 10 days following additional 4-day recovery. ASCs transduced with nontarget shRNA (Sigma) served as negative controls. Stable silencing of IGF-I in ASCs was determined by SYBR Green assay (Biorad) and ELISA (RnD System).
Gehmert S., Wenzel C., Loibl M., Brockhoff G., Huber M., Krutsch W., Nerlich M., Gosau M., Klein S., Schreml S., Prantl L, & Gehmert S. (2014). Adipose Tissue-Derived Stem Cell Secreted IGF-1 Protects Myoblasts from the Negative Effect of Myostatin. BioMed Research International, 2014, 129048.
+ Open protocol
+ Expand
3

Comprehensive Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Comprehensive gene expression analysis was performed at NIMGenetics (Madrid, Spain). Samples of NCI-H520 and HEp-2 cells upon deadenylase silencing were hybridized to microarrays SurePrint G3 Human GE 60 K Microarray, and Whole Human Genome Agilent 4 × 44 K oligo Microarray (Agilent Technologies, Inc., Santa Clara, CA, USA). To exclude any possible transcripts affected by the transfection procedure itself, we used non-target shRNA (Sigma), pLKO.1 empty vector (Sigma), and wild-type cells as controls of expression. Raw microarray data files are available in the GEO database with accession numbers GSE67536 and GSE67598 [50 (link),51 (link)].
Kyritsis A., Papanastasi E., Kokkori I., Maragozidis P., Chatzileontiadou D.S., Pallaki P., Labrou M., Zarogiannis S.G., Chrousos G.P., Vlachakis D., Gourgoulianis K.I, & Balatsos N.A. (2022). Integrated Deadenylase Genetic Association Network and Transcriptome Analysis in Thoracic Carcinomas. Molecules, 27(10), 3102.
+ Open protocol
+ Expand
4

Cyclin D1 Knockdown Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cyclin D1-specific siRNA A (siD1-A, 5’-CCAAUAGGUGUAGGAAAUAGCGCTG-3’) was from Integrated DNA Technologies. Cyclin D1-specific siRNA B (siD1-B, 5’-AACACCAGCTCCTGTGCTGCG-3’), C (siD1-C, 5’-GCCCTCGGTGTCCTACTTCAA-3’), control siRNA (AllStars Negative control) were from Qiagen (Valencia, CA, USA). Cyclin D1 shRNA (5’-GCCAGGATGATAAGTTCCTTT-3’), and non-target shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) were from Sigma-Aldrich (Sigma-Aldrich, St. Louis, MO, USA). The following antibodies were used: anti-cyclin D1 H295, RAD51 H-92, cyclin A C-19, GST Z-5, CDK2 M-2, CDK4 C-22 antibodies (Santa Cruz Biotechnologies, Santa Cruz, CA, USA), cyclin D3 DCS-22, antibody against the C-terminus of cyclin D1 (Ab3, Thermo Fisher Scientific, Waltham, MA, USA), anti-BRCA2 OP-95 antibody (EMD Millipore), anti-HA 12CA5, CDC25A, γH2AX antibodies (abcam, Cambridge, MA, USA), anti-β actin AKR-002, GAPDH AKR-001antibodies (Sigma-Aldrich). Anti-phospho-Ser3291 BRCA2 antibody was described previously (23 (link)).
Chalermrujinanant C., Michowski W., Sittithumcharee G., Esashi F, & Jirawatnotai S. (2015). Cyclin D1 promotes BRCA2-Rad51 interaction by restricting cyclin A/B-dependent BRCA2 phosphorylation. Oncogene, 35(22), 2815-2823.
+ Open protocol
+ Expand
5

Lentivirus Production for shRNA Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
To obtain lentivirus supernatants, HEK293T cells were transiently transfected with pLKO.1-puro-CMV-tGFP containing shRNA sequences (Sigma-Aldrich Japan), pMISSION GAG POL (Sigma-Aldrich Japan), and pMISSION VSV-G (Sigma-Aldrich Japan). Forty-eight hours later, the viral supernatant was collected and utilized for infection. The vector-transduced cells were selected by medium containing puromycin (1.0 μg/mL for HL60 and 2.5 μg/mL for primary samples) and subjected to assays in vitro. Non-target shRNA was a nonfunctional construct purchased from Sigma-Aldrich Japan. The target sequences, from 5′ to 3′, were GGGCCTGGAGATTTGGAATAG (ADAM8sh_1) and GGAATAGTCAGGACAGGTTCC (ADAM8sh_2).
Miyauchi M., Koya J., Arai S., Yamazaki S., Honda A., Kataoka K., Yoshimi A., Taoka K., Kumano K, & Kurokawa M. (2018). ADAM8 Is an Antigen of Tyrosine Kinase Inhibitor-Resistant Chronic Myeloid Leukemia Cells Identified by Patient-Derived Induced Pluripotent Stem Cells. Stem Cell Reports, 10(3), 1115-1130.
+ Open protocol
+ Expand
6

Generating shRNA and Overexpression Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The shRNA constructs were generated by inserting shRNA fragments (of METTL3, DDX23) into the shLenti vectors (constructs were purchased from Origene, Rockville, MD, USA), all shRNA sequence used are provided in Supplementary Table S1. The overexpression constructs were generated by inserting the fragments of the full-length coding region of DDX23 into pcDNA3.1 plasmids. The functional constructs, nontarget shRNA (Sigma-Aldrich), and negative control of the corresponding constructs were diluted in the medium containing 6 μg/mL polybrene. The transfection of constructs into cells was performed using Lipofectamine 2000 (Invitrogen). Three days after the transfection, 5 μg/mL of puromycin was added to select successfully transfected cells.
Lin C., Li T., Wang Y., Lai S., Huang Y., Guo Z., Zhang X, & Weng S. (2023). METTL3 enhances pancreatic ductal adenocarcinoma progression and gemcitabine resistance through modifying DDX23 mRNA N6 adenosine methylation. Cell Death & Disease, 14(3), 221.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!