Hepa 1–6 mouse hepatoma cells (ATCC CRL-1830) were maintained on culture-treated plastic in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum and 100 U/mL penicillin and streptomycin. For luciferase experiments, cells were plated on 24-well tissue culture dishes and co-transfected with 10 ng of pMiRCheck2 miRNA sensor plasmid and 500 ng of pKT2-Fah-TuDstd, pKT2-Fah-TuDtail, or pGeneClip (Promega) plasmids using Lipofectamine 3000 Reagent (Invitrogen). Firefly and Renilla luciferase activity was determined 24 (TuD) or 48 h (pGeneClip) post-transfection using the Dual-Luciferase Reporter Assay System (Promega).
Pgeneclip
Manufactured by Promega
PGeneClip is a laboratory instrument that enables users to control gene expression through RNA interference (RNAi) technology. It is designed for efficient and targeted gene silencing in various experimental systems.
Automatically generated - may contain errors
Lab products found in correlation
Oligofectamin, by Thermo Fisher Scientific (1 mentions)
On targetplus smartpool, by Thermo Fisher Scientific (1 mentions)
Dharmafect duo, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
3 protocols using pgeneclip
1
Measuring miRNA Sensor Luciferase Activity
2
Silencing MTMR7 Using siRNA and shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiRNA oligonucleotides were from Dharmacon (SMARTpool: ON-TARGETplus, Thermo Scientific, Lafayette, CO). Cells (500.000/well of a 6-well plate) were transiently transfected for 48 h with a mixture of four MTMR7-specific siRNAs provided as a single reagent or control siRNA using Oligofectamin (Thermo Scientific) as recommended by the manufacturer. ShRNA plasmids were from Qiagen (SureSilencing #KH17308, Hilden, Germany). One control and four separate shRNA designs (MTMR7 NM_004686) were provided and packaged in the same plasmid backbone (pGeneClip, Promega). Cells (500.000/well of a 6-well plate) were transfected with the shRNA-control plasmid or a mixture (1:1:1:1) of the four MTMR7-shRNA plasmids (500 ng/well) using Turbofect for 6 h followed by cultivation in full medium for 1-7 days as suggested by the manufacturer.
3
Silencing CD95L in Glioblastoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The shRNA sequences were cloned into Promega pGeneClip vectors by PCR-based outward full vector amplification, followed by head-to-head ligation with the following PCR primer sequences:
SCRMBL control sequence (5′→3′):
Sense-oligo:tgtca ATAGCTCTAGTAGCGCTAGC gcagtctggagtttcaaaagtagac .
Anti-oligo:ggaag ATAGCTCTAGTAGCGCTAGC gagatcttgggcctctgcc .
CD95L sequence (5′→3′):
Sense-oligo:gagacATTAGGTGAGTTGAGGAGCTAcgcagtctggagtttcaaaagtagac .
Anti-oligo:gagacATTAGGTGAGTTGAGGAGCTAcgagatcttgggcctctgcc .
Sense-oligos were obtained containing a 5′-phosphorylation for ligation. Target sequences (reverse complement) are shown in upper case. All vectors were sequence verified before transfection. Transfection of U87-MG and U251-MG cells with sh[SCRMBL] or sh[CD95L] vectors was performed using Dharmafect Duo (Thermo Fisher Scientific) according to the manufacturer’s protocols. Transfected cells were selected starting 2 days after transfection using increasing amounts of puromycin over a period of 2 weeks and subsequently cultured in RPMI-1640 with 10% FBS and 1 μg/ml puromycin. Endogenous levels of CD95L in the sh[SCRMBL] and sh[CD95L] vector transfected cells were quantified by ELISA analysis of 50 μg whole-cell lysate proteins with an ELISA set-up developed at Apogenix using a calibration curve of APG293.
SCRMBL control sequence (5′→3′):
Sense-oligo:
Anti-oligo:
CD95L sequence (5′→3′):
Sense-oligo:
Anti-oligo:
Sense-oligos were obtained containing a 5′-phosphorylation for ligation. Target sequences (reverse complement) are shown in upper case. All vectors were sequence verified before transfection. Transfection of U87-MG and U251-MG cells with sh[SCRMBL] or sh[CD95L] vectors was performed using Dharmafect Duo (Thermo Fisher Scientific) according to the manufacturer’s protocols. Transfected cells were selected starting 2 days after transfection using increasing amounts of puromycin over a period of 2 weeks and subsequently cultured in RPMI-1640 with 10% FBS and 1 μg/ml puromycin. Endogenous levels of CD95L in the sh[SCRMBL] and sh[CD95L] vector transfected cells were quantified by ELISA analysis of 50 μg whole-cell lysate proteins with an ELISA set-up developed at Apogenix using a calibration curve of APG293.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!