The 3′UTR of EZH2 was amplified by PCR from genomic DNA of HEK293T cells with the following primers: Forward: 5′ AGGTCTAGACCTCTGAAACAGCTGCCTTA 3′ and Reverse: 5′ CCTGAGCTCGCATTATTGCAAAAATTCAC 3′. The 3′UTR was cloned downstream of the luciferase coding sequence in the pMIR-REPORT Luciferase vector (Promega). The construct was confirmed by sequencing. Hsa-miR-138 mimics and none-target control were purchased from GenePharma. And the sequence are as follows: Hsa-miR-138 mimics, Forward: 5′AGCUGGUGUUGUGAAUCAGGCCG 3′and Reverse: 5′GCCUGAUUCACAACACCAGCUUU 3′; none-target control, Forward: 5′ UUCUCCGAACGUGUCACGUTT 3′and Reverse: 5′ ACGUGACACGUUCGGAGAATT 3′.
HEK293T cells were plated in 24-well dishes overnight before transfection. Hsa-miR-138 mimics or none-target control was transfected into HEK293T cells as well as 200 ng of pMIR-REPORT-EZH2 and 20 ng of pRL-renilla by lipofectmine 2000 (Invitrogen). Medium was changed 6 h later. After 48 h, luciferase assay was performed with dual-luciferase reporter assay systems (Promega) according to the manufacturer’s instructions. Measurements were carried out in triplicates and expressed as mean ± SD. Three independent transfection experiments were performed.
HEK293T cells were plated in 24-well dishes overnight before transfection. Hsa-miR-138 mimics or none-target control was transfected into HEK293T cells as well as 200 ng of pMIR-REPORT-EZH2 and 20 ng of pRL-renilla by lipofectmine 2000 (Invitrogen). Medium was changed 6 h later. After 48 h, luciferase assay was performed with dual-luciferase reporter assay systems (Promega) according to the manufacturer’s instructions. Measurements were carried out in triplicates and expressed as mean ± SD. Three independent transfection experiments were performed.