Dneasy plant mini

We developed a genetic map describing AFLP (amplified fragment length polymorphism) molecular markers closely-linked to dicamba tolerance in S. arvensis [8 (link)]. The two closest markers that were identified and sequenced were 1.58 and—6.35 map units flanking the resistance locus, and were designated M5 and M2, respectively [8 (link)]. To confirm the presence of marker closely-linked to dicamba tolerance in the hybrid progeny, PCR was conducted using primers generated from the M5 molecular marker (forward primer: GGCCGCGAGACATTGGTGA and reverse primer: TCTCTCGTGACCCTTTACAATTAG). The expected amplicon size was 225 bp. Genomic DNA was extracted from the leaf tissue of hybrid progeny and their parental plants using DNeasy^® Plant Mini (QIAGEN, Mississauga, ON, Canada). Thirty cycles of PCR were conducted using the following conditions: initial denaturation at 94°C for 3 min, followed by 30 cycles of 94°C for 30 seconds, 56°C for 30 sec and 72°C for 45 sec with a final extension at 72°C for 7 min. Dicamba tolerance was determined by the presence of the expected 225 bp amplification product.

Plant material originated from four grapevine collections (see S1 Table for their detailed contributions in term of accessions and characterization data):
Total DNA was extracted by each partner with Qiagen DNeasy Plant Mini or Maxi Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions except that 1% polyvinylpyrrolidone (PVP 40,000) and 1% β-mercapto-ethanol were added to the AP1 buffer. DNA was quantified with Quant-it Picogreen dsDNA Assay Kits (InVitrogen, Life Technologies).

Genomic DNA was extracted using either the NucleoSpin Plant II kit (Macherey-Nagel-MN) or the Dneasy Plant Mini (Qiagen) kits, following the manufacturers’ protocols. The quality of the DNA obtained was evaluated by electrophoresis using TAE 1X buffer and 2% agarose gel containing GelRed (Amersham).

Genomic DNA was extracted from samples of microspore cultures of rapeseed and barley at the stage of proembryo formation (4 days), in non-treated conditions and after short treatments with 2.5 μM AzaC. The DNA extraction was performed using a plant genomic DNA extraction kit (DNeasy Plant Mini, Qiagen) as previously described (Solís et al., 2014 (link)). A MethylFlash Methylated DNA Quantification Kit (Colorimetric; Epigentek, Farmingdale, NY, USA) was used for the quantification of the global DNA methylation according to the manufacturer’s instruction, using 200 ng of genomic DNA (Testillano et al., 2013 (link)) collected from various culture plates of each sample (for barley: 20–25 plates of 50 mm diameter and 1.5 mL of culture medium each; for rapeseed: 8–10 plates of 90 mm diameter and 15 mL of culture medium each). Three biological (independent culture experiments) and two analytical (DNA methylation colorimetric assays) replicates per sample were taken and mean percentages of 5-methyl-deoxy-cytidine (5mdC) of total DNA were calculated. The results were shown in histograms in which columns represented mean values and bars represented SEM. Significant differences between non-treated (control) cultures and AzaC-treated cultures were tested by Student’s t-test at P ≤ 0.05.