Pegfp c1 flag ku70

Manufactured by Addgene

PEGFP-C1-FLAG-Ku70 is a plasmid that expresses the Ku70 protein fused to a FLAG tag and GFP. Ku70 is a component of the Ku heterodimer, which is involved in the non-homologous end joining (NHEJ) pathway of DNA double-strand break repair.

Automatically generated - may contain errors

Lab products found in correlation

Miniprep plasmid extraction, by Qiagen (1 mentions) Gibson assembly master mix, by New England Biolabs (1 mentions) Quickchange 2 xl kit, by Agilent Technologies (1 mentions) Synthetic oligonucleotides, by Integrated DNA Technologies (1 mentions) Hplc purified oligos, by Integrated DNA Technologies (1 mentions) Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions) Quikchange multi site directed mutagenesis kit, by Agilent Technologies (1 mentions)

3 protocols using pegfp c1 flag ku70

Plasmid Construction and Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ku70 and PARP1 were PCR amplified from pEGFP-C1-FLAG-Ku70 (Addgene) and pCMV-3xFLAG-PARP1 (Addgene), respectively, then cloned into a Bpu102I/MunI digested pmiRFP670 (Addgene) backbone with Gibson assembly master mix (NEB). The pDDX3X^L19A/L21A-GFP and pmiRFP670-PARP1-E988 K constructs were generated via the QuickChange II XL Kit (Agilent) as described by the manufacturer’s protocol using HPLC-purified oligos (Integrated DNA Technologies). Deletion constructs were generated from pDDX3X^L19A/L21A-GFP via Gibson assembly following the manufacturer’s protocol (NEB) and expression was confirmed by western blot. Guide RNA expression vectors were constructed by annealing synthetic oligonucleotides (Integrated DNA Technologies) encoding the target sequences and inserting into the pMLM3636 vector following the depositor’s protocol (Addgene). All constructs were extracted from transformed bacteria via miniprep plasmid extraction (Qiagen) and verified by Sanger sequencing.
sgPARP1–1: CGAGTCGAGTACGCCAAG
sgPARP1–3: ACCCTGACGTTGAGGTGGAT DDX3X-L19A-L21A_F1:
GCAGTTTGCTGGCGCAGACGCGAACTCTTCAGATAATCA DDX3X-L19A-L21A_R1:
CTGATTATCTGAAGAGTTCGCGTCTGCGCCAGCAAACTG PARP1-E988K-Fwd:
ATGACACCTCTCTACTATATAACAAGTACATTGTCTATGATATTGC PARP1-E988K-Rev:
GCAATATCATAGACAATGTACTTGTTATATAGTAGAGAGGTGTCAT

Cargill M.J., Morales A., Ravishankar S, & Warren E.H. (2021). RNA helicase, DDX3X, is actively recruited to sites of DNA damage in live cells. DNA repair, 103, 103137.

+ Open protocol

+ Expand

Plasmid-based Expression of ATG5 and Ku Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nucleotides covering 1 to 192 a.a. of human ATG5 cDNA insert in the pcDNA3 construct cut and ligated into a pCMV-3Tag-6 Flag expression vector. For GST-tagged protein production, human Ku70 was cloned into the BamHI and EcoRI sites of bacterial expression vector pGEX-4 T-1-3xFLAG (Addgene, #129570) followed by digestion with BamHI and EcoRI from pEGFP-C1-FLAG-Ku70 (Addgene, #46957) plasmid. hATG5 vector was kindly gifted from Noboru Mizushima. Flag and GFP tagged human Ku70 (Addgene, #46957) and Ku80 (Addgene, #46958), pmCherry-ATG5 (Addgene, #13095) plasmid were all provided by Addgene.

Demirbag-Sarikaya S., Akkoc Y., Turgut S., Erbil-Bilir S., Kocaturk N.M., Dengjel J, & Gozuacik D. (2022). A novel ATG5 interaction with Ku70 potentiates DNA repair upon genotoxic stress. Scientific Reports, 12, 8134.

+ Open protocol

+ Expand

Construction and Characterization of ZNF281 Plasmids

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

pEGFP-C1-FLAG-Ku70 (Addgene plasmid, #46957) and pEGFP-C1-FLAG-XRCC4 (Addgene plasmid, #46959) were a gift from Steve Jackson [38 (link)]. pEGFP-C1-ZNF281 and mCherry-C1-ZNF281 were sub-cloned from pcDNA-ZNF281-FLAG.
Site-directed mutants of pcDNA-ZNF281-FLAG, pEGFP-C1-ZNF281 or mCherry-C1-ZNF281 were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent #200523) (for phosphomutants) or with the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent #200514) (for the zinc-fingers mutant).
Expression vectors with different domains of ZNF281 were obtained by molecular cloning from pcDNA-ZNF281-FLAG plasmid.
The sequence of all plasmids generated was checked by sequencing. All the primers used for cloning and mutagenesis are listed in the Supplementary Table S1.

Nicolai S., Mahen R., Raschellà G., Marini A., Pieraccioli M., Malewicz M., Venkitaraman A.R, & Melino G. (2019). ZNF281 is recruited on DNA breaks to facilitate DNA repair by non-homologous end joining. Oncogene, 39(4), 754-766.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!