The largest database of trusted experimental protocols

Shmmp 2

Manufactured by GenePharma
Sourced in China

ShMMP‐2 is a laboratory equipment product. It is used for the detection and analysis of Matrix Metalloproteinase-2 (MMP-2), an enzyme involved in various biological processes. The core function of ShMMP‐2 is to facilitate the measurement and quantification of MMP-2 levels in samples.

Automatically generated - may contain errors

3 protocols using shmmp 2

1

Targeted knockdown of TMPRSS11f and MMP-2 in THP-1 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short hairpin RNAs (shRNAs) targeting the human TMPRSS11f gene, encoding HAT‐L4, and scrambled shRNAs were synthesized (GenePharma, Shanghai, China). In addition, shRNAs targeting the human MMP‐2 gene (shMMP‐2) and scrambled shRNAs (shNC) were synthesized (GenePharma). Lentiviruses containing the shRNAs were transduced into cultured THP‐1 cells. After 12 hours, the medium was replaced by RPMI 1640. The cells were collected after 72 hours and analyzed using flow cytometry for transduction efficiency. qRT‐PCR was used to analyze HAT‐L4 and MMP‐2 mRNA levels to identify shRNAs with the best silencing efficiency. Sequences of the TMPRSS11f gene targeted by the selected shRNAs are shown in Figure S1. Sequences for MMP‐2 knocking down shRNAs are TTCTCCGAACGTGTCACGT (shNC) and GCGAGTGGATGCCGCCTTTAA (shMMP‐2).
+ Open protocol
+ Expand
2

Regulation of SPRY2 and MMP-2 in SRA01/04 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short hairpin RNA (shRNA) targeting SPRY2 (shSPRY2; 10 nM; 5′-CCUUACCAUUCCUCCACUUTT-3′), shRNA targeting MMP-2 (shMMP-2; 10 nM; 5′-GCUGACCUGGAAGAGAACATT-3′) and their negative control (shNC; 10 nM; 5′-UUCUCCGAACGUGUC-3′), miR-124 mimics (10 nM; 5′-AACAUUCAACGCUGUCGGUGAGU-3′), NC mimics (10 nM; 5′-UUCUCCGAACGUGUCACGUTT-3′), miR-124 inhibitor (10 nM; 5′-ACUCACCGACAGCGUUGAAUGUU-3′) and NC inhibitor (10 nM; 5′-CAGUACUUUUGUGUAGUACAA-3′) were purchased from Shanghai GenePharma Co., Ltd. Cell transfection was performed in SRA01/04 (1×105 cells/well) using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) for 48 h at 37°C according to the manufacturer's instructions. The full-length of SPRY2 and MMP-2 were subcloned into pcDNA3.1 (10 nM; Shanghai GenePharma Co., Ltd.) to overexpress SPRY2 and MMP-2 levels with empty pcDNA3.1 (10 nM; Shanghai GenePharma Co., Ltd.) serving as the control. The efficiency of transfection was determined in each experiment using reverse transcription-quantitative (RT-q)PCR 48 h post-transfection. Subsequent experiments were performed at 48 h post-transfection.
+ Open protocol
+ Expand
3

Measuring miR-760 and MMP2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
MiR-760 and NC mimics, shRNA for MMP2 knockdown (sh-MMP2) and the negative control (sh-NC), and a construct for MMP2 overexpression and the control were manufactured at GenePharma Company (Shanghai, China). The sequences mentioned in this article are shown in Table 2. Lipofectamine 3000 (Invitrogen) was utilized to transfect cells according to the manufacturer's recommendations. The relative expression of miR-760 and MMP2 was measured 48 hours later using a qRT‒PCR experiment.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!