Pgex 5x 2

Manufactured by GE Healthcare

Sourced in United States

PGEX-5X-2 is a laboratory equipment designed for protein expression and purification. It is a plasmid that allows for the production of recombinant proteins in Escherichia coli (E. coli) cells. The PGEX-5X-2 plasmid contains the glutathione S-transferase (GST) gene, which can be used to express and purify proteins of interest fused to the GST tag.

Automatically generated - may contain errors

Lab products found in correlation

Glutathione sepharose 4b, by GE Healthcare (1 mentions) Pfastbachtb, by Thermo Fisher Scientific (1 mentions) Nitroblue tetrazolium chloride, by Bio-Rad (1 mentions) 5 bromo 4 chloro 3 indolyl phosphate p toluidine, by Bio-Rad (1 mentions) Alkaline phosphatase conjugated goat anti rabbit immunoglobulin, by Merck Group (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

PGEX-5X-1/2 (2 citations)

5 protocols using pgex 5x 2

Purification and Characterization of Bqt4 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

A part of the bqt4⁺ ORF corresponding to the amino acids 2–181 was amplified and cloned into pGEX-5X-2 (GE Healthcare). The Escherichia coli BL21-CodonPlus (Stratagene) was transformed with the plasmid, and the glutathione S-transferase (GST)-Bqt4 fusion protein was purified using Glutathione Sepharose 4B (GE Healthcare). GST or GST-Bqt4_2-181 proteins bound to glutathione beads were mixed with S. pombe cell extracts in TNE buffer (40 mM Tris–HCl [pH 7.5], 150 mM NaCl, 5 mM EDTA, 50 mM NaF, 20 mM β-glycerophosphate) at 4°C for 2 h and washed with TNE buffer. The protein complexes were boiled in SDS sample buffer and analyzed by SDS-PAGE, followed by immunoblotting and Coomassie Brilliant Blue (CBB) gel staining.

Inoue H., Horiguchi M., Ono K, & Kanoh J. (2019). Casein kinase 2 regulates telomere protein complex formation through Rap1 phosphorylation. Nucleic Acids Research, 47(13), 6871-6884.

+ Open protocol

+ Expand

Cloning and Expression of Mouse FAK

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse FAK cDNA was cloned into pFASTBac-HTb (Invitrogen) between BamHI and KpnI sites to form pFastFAK. GST-PDCD6 was generated by cloning the full-length open reading frame as an EcoRI fragment into pGEX-5X-2 (GE Healthcare). GST-paxillin (chicken; a.a.1-151) in pGEX-5X was described previously 5 (link); pCR-HA-IKKα (Addgene #15469), pLUdR-puro-YFP-FAK-Y180A/M183A (FAK180) (gift of M. Schaller, West Virginia University), NFκB-Luciferase (NK-Luc; gift of E. Kurenova, RPCI); pCMV-Renilla (gift of A. Bakin, RPCI), pCMV4-p100 (Addgene #23287). Y->F mutants in untagged IKKα (gift of E. Kurenova) were generated by site-directed mutagenesis using the primers msIKKa-Y187F: TGTGGGAACATTGCAGTTTTTGGCCCCAGAGCTCTTT, msIKKa-Y198F: CTTTGAAAATAAGCCGTTCACAGCCACTGTGGATTATTGG, and msIKKa-Y500F: GAGAGATATAGTGAGCAGATGACTTTTGGGATATCTTCAG.

Dwyer S.F., Gao L, & Gelman I.H. (2015). Identification of Novel Focal Adhesion Kinase Substrates: Role for FAK in NFκB Signaling. International Journal of Biological Sciences, 11(4), 404-410.

+ Open protocol

+ Expand

Western Blot Detection of MCPyV VP1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The proteins in the cell lysates and culture media were separated by 12.5% SDS—PAGE and were electrophoretically transferred onto a nitrocellulose membrane. The membrane was then blocked with 5% skim milk in 50 mM Tris—HCl (pH 7.4), 150 mM NaCl, and reacted with a rabbit anti-MCPyV VP1 polyclonal antibody. Detection of rabbit IgG antibody was achieved by using alkaline phosphatase-conjugated goat anti-rabbit immunoglobulin (Chemicon International). Nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate P-toluidine were used as coloring agents (Bio-Rad Laboratories). The MCPyV VP1 antigen to generate a rabbit anti-MCPyV VP1 polyclonal antibody was prepared as follows. A glutathione S transferase-MCPyV VP1 fusion protein was bacterially produced from pGEX5X/MCPyVVP1, where MCPyV VP1 gene was inserted into the BamHI-XhoI site of pGEX5X-2 (GE Healthcare), and purified by glutathione Sepharose chromatography.

Li T.C., Iwasaki K., Katano H., Kataoka M., Nagata N., Kobayashi K., Mizutani T., Takeda N., Wakita T, & Suzuki T. (2015). Characterization of Self-Assembled Virus-Like Particles of Merkel Cell Polyomavirus. PLoS ONE, 10(2), e0115646.

+ Open protocol

+ Expand

Generating Survivin-Myc/FLAG and GST-Survivin

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate hSurvivin-Myc/FLAG, human survivin fused to Myc and FLAG tags at its C-terminus was first excised from a commercial cDNA clone (OriGene). The survivin-Myc/FLAG insert was then used as the template in a PCR reaction with primers hSVN-EcoRI-F (5′-GCGATCGAATTCGTCGACTGG-3′) and hSVN-XbaI-R (5′-ACTCCTCTAGAAAACCTTATCGTCGTC-3′). Digested insert was then ligated into pcDNA3.1 (Thermo Fisher Scientific) and the construct was validated by sequencing. To generate the GST-hSurvivin plasmid used for protein purification, the survivin ORF (but not Myc or FLAG tag sequence) was excised from a commercial cDNA clone (OriGene) using EcoRI and NotI, and ligated into pGEX-5X-2 (GE Healthcare Life Sciences).

Fenstermaker R.A., Figel S.A., Qiu J., Barone T.A., Dharma S.S., Winograd E.K., Galbo P.M., Wiltsie L.M, & Ciesielski M.J. (2018). Survivin Monoclonal Antibodies Detect Survivin Cell Surface Expression and Inhibit Tumor Growth in vivo. Clinical cancer research : an official journal of the American Association for Cancer Research, 24(11), 2642-2652.

+ Open protocol

+ Expand

ERα and PAK4 Protein Expression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Flag-tagged ERα expression vectors were provided by Dr. Muyan M (Department of Biochemistry and Biophysics, University of Rochester Medical Center). GST-tagged ERα and deletions were sub-cloned in the pGEX-5x-2 (GE Healthcare, Waukesha, WI, USA) vectors. PAK4 full-length vectors were provided by Dr Audrey Minden (New Jersey, USA). GST-tagged PAK4 and delete mutations were inserted into pGEX-5x-1 backbone. si-PAK4 (sense 5′-CUUCAUCAAGAUUGGCGAGtt-3′) were designed and synthesized by Shanghai GeneChem Co., Ltd. Estrogen receptor β, ARE-luc, PRE-luc, ERE-luc, AR, and DHT was kindly provided by Dr Zhao Y. PRA and PRB expression vectors were kindly provided by Dr. P. Chambon. LIFR CRISPR/Cas9 KO Plasmid (h) was purchase from Santa Cruz Biotechnology (sc-400861).

Li Y., Zhang H., Zhao Y., Wang C., Cheng Z., Tang L., Gao Y., Liu F., Li J., Li Y., Li Y., Geng N., Rui X., Teng Y., Liu Y., Cao L., Kumar R., Jin F, & Li F. (2018). A mandatory role of nuclear PAK4-LIFR axis in breast-to-bone metastasis of ERα-positive breast cancer cells. Oncogene, 38(6), 808-821.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!