Primescript first strand synthesis kit

Total RNA was extracted from ten adults of a laboratory strain of An. sinensis [27 (link)] by using TRIzol (Invitrogen, CA, USA) according to the manufacturer’s protocol. First-strand cDNA was synthesized from total RNA (1 µg) using PrimeScript First Strand Synthesis Kit according to the manufacturer’s instructions (Takara, Dalian, China). The full length open reading frame sequence of the GABA-gated chloride channel gene was amplified by PCR using the primers (AsRDLfullcd-F:ATGTCGCTAACCATCGAAGTTCCGC; AsRDLfullcd-R: TTACTTATCCTCACCGAGCAGCA) commercially synthesized by Invitrogen (China). The PCR mixture (50 μl) consisted of 2 μl cDNA template, 1 μl PrimeStar^® GXL (Takara), 10 μl 5× Buffer, 4 μl 2.5 μM dNTPs, 1 μl 10 mM each primer, and 31 μl ddH₂O. The thermal cycling profile consisted of an initial step of denaturation at 95 °C for 3 min; followed by 36 cycles of 98 °C for 10 s, 55 °C for 15 s, 68 °C for 2 min; and a final extension step at 68 °C for 10 min. The PCR products were gel purified (Takara, Dalian, China) and then subcloned into pEasy-T1 and transformed the Escherichia coli Trans 5α strain (Transgen, Beijing, China). The nucleotide sequences of As-RDL gene were identified by direct sequencing of PCR products and/or clone sequencing from two directions.

TRIzol™ reagent (Invitrogen, Carlsbad, CA, United States) was used to isolate total RNA. Two micrograms of total RNA was used for reverse transcription using the PrimeScript® first Strand Synthesis Kit (TaKaRa, Tokyo, Japan). Real-time RT–qPCR was performed using a QuantiTect SYBR® Green RT–PCR kit (QIAGEN, Düsseldorf, Germany). The primer sequences for RT–qPCR are shown in Table 1. GAPDH was used for standardization. The relative expression of the lncRNA AK035396, Mterf1, Caspase3, Caspase9, COX II, and CYTb was determined by the 2^−ΔΔCt method.