The largest database of trusted experimental protocols

293t human embryonic kidney cell line

Sourced in United States

The 293T human embryonic kidney cell line is a commonly used cell line in biological research. It is derived from human embryonic kidney cells that have been transformed with the SV40 large T antigen. The 293T cell line is known for its high transfection efficiency and is often used for the production of recombinant proteins and viral vectors.

Automatically generated - may contain errors

6 protocols using 293t human embryonic kidney cell line

1

Lipid nanoparticle-mediated mRNA delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols
DOTAP were purchased from Avanti Polar Lipids (Alabaster, AL, USA). Cholesterol and protamine sulfate were purchased by Sigma-Aldrich (St Louis, MO, USA). Other chemicals were purchased from Sigma-Aldrich unless otherwise noted. mMESSAGE mMACHINE™ T7 Transcription Kit and MEGAclear™ Transcription Clean-Up Kit, LipofectamineTM2000, DMEM and serums were purchased from Thermo Fisher Scientific (Waltham, MA, USA). C26 Mus musculus colon carcinoma cell line and 293T human embryonic kidney cell line were purchased from the American Type Culture Collection (ATCC) (Manassas, VA, USA). BALB/c mice were obtained from Beijing HFK Bio-technology Co. Ltd. (Beijing, China) and maintained under specific pathogen-free conditions. All animal procedures were approved and controlled by the Institutional Animal Care and Treatment Committee of Sichuan University and carried out according to the Animal Care and Use Guidelines of Sichuan University.
+ Open protocol
+ Expand
2

Cell Line Maintenance Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MGC-803 and SGC-7901 human gastric cancer cell lines were purchased from the Institute of Cell Biology (Shanghai, China, http://www.cellbank.org.cn). The 293T human embryonic kidney cell line was obtained from the American Type Culture Collection (ATCC, MD, USA). MGC-803 and SGC-7901 cells were maintained in RPMI-1640 medium, while 293T cells were maintained in DMEM. All media contained 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 μg/ml streptomycin (Invitrogen, Carlsbad, CA, USA).
+ Open protocol
+ Expand
3

Genetic Manipulation of LDHA and LDHB

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 293T human embryonic kidney cell line, and PANC-1 and Capan-2 pancreatic cancer cell lines were purchased from the American Type Culture Collection and were previously tested for mycoplasma contamination. Cells were routinely cultured in Dulbecco’s Modified Eagle Medium (Macgene, China) with 10% fetal bovine serum (Hyclone, USA). The FLAG-tagged LDHB eukaryotic expression vector was generated by inserting PCR-amplified fragments of the LDHB gene into pcDNA3 (Invitrogen, USA). Lentiviral shRNA vectors of LDHA and LDHB were constructed by cloning short hairpin RNA fragments into pSIH-H1-Puro (System Biosciences, USA). Target sequences are as follows, LDHA shRNA: 5’- ATCCAGTGGATATCTTGACCTACG -3’; LDHB shRNA: 5’- GGATATACCAACTGGGCTATT -3’. Lentiviruses were produced by co-transfection of HEK293T cells with recombinant lentivirus vectors and pPACK Packaging Plasmid Mix (System Biosciences, USA) using PEI reagent (Polyscience, USA). Lentiviruses were used to infect target cells in accordance with the manufacturers’ instructions. Myc-TERT, Flag-TERT, and GST-TERT plasmids were described previously (15 (link)). Sodium pyruvate, Sodium lactate, Methyl pyruvate and IPTG were products from Sigma (USA). 2-DG and AT-101 were purchased from Selleck (USA).
+ Open protocol
+ Expand
4

Glioma and Kidney Cell Culture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
H4, U87, and U118 human glioma cell lines and 293 T human embryonic kidney cell line were purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C in a humidified incubator of 5% CO2. Cells were transiently transfected with polyetherimide for 293 T cells to detect the efficiency of sh-ARHGEF16 or sh-CKAP5 constructs (Additional file 2: Figure S1A-C), or with Lipofectamine 2000 for glioma cell lines according to the manufacturer’s instructions. LV systems were used to establish stable glioma cell lines overexpressing GLI2A or ARHGEF16 or to knock down GLI2 or ARHGEF16. Puromycin (0.5 μg/ml) was added to cultures to maintain stable overexpression in the cell lines.
+ Open protocol
+ Expand
5

Cell Culture Protocol for Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
The B16-F0 mouse melanoma cell line, HBEC3-KT human bronchial epithelial cell line, 4T1 mouse breast cancer cell line, 293T human embryonic kidney cell line, A375 human malignant melanoma cell line and B×PC-3 human pancreatic cancer cell line from American Type Culture Collection (ATCC, Manassas, VA, USA), and Huh7 human liver cancer cell line from Riken Bioresource Center, Japan, were cultured in Dulbecco’s modified Eagle medium (DMEM) culture medium supplemented with 10% foetal bovine serum (FBS), 100 U mL−1 penicillin and 100 μg mL−1 streptomycin. The cells were grown in a 5% carbon dioxide (CO2) humidified incubator at 37 °C until 70–80% confluence.
+ Open protocol
+ Expand
6

Regulation of Tumor Angiogenesis by KLF5

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human umbilical vein endothelial cells (HuVECs) were purchased from Life Technologies and cultured in Medium 200 with low serum growth supplement (LSGS) (Carlsbad, CA). PC-3 and DU 145 human prostate cancer cell lines and the 293 T human embryonic kidney cell line were purchased from American Type Culture Collection (ATCC) (Manassas, VA), and propagated following ATCC’s instructions.
SiRNA against KLF5 (SiKLF5), developed in a previous study [64 (link)] with the sequence of AAGCUCACCUGAGGACUCATT, was used to knock down KLF5 in human cells at a concentration of 150 nM or as indicated in related figures. The control siRNA (siCtrl), AAUUCUCCGAACGUGUCACGUTT, was purchased from Thermo Fisher (Waltham, MA) used to bring the siRNA concentration to the same in concentration gradient RNAi assay.
PI3K inhibitors Wortmannin and LY294002 were purchased from Cell Signaling Technology (Danvers, MA), and dissolved in dimethyl sulfoxide (DMSO).
Antibodies used in this study included the following: anti-HIF1α and anti-PDGF-B from Novus Biologicals (Littleton, CO), anti-PDGF-D from Santa Cruz (Santa Cruz, CA), anti-phospho-AKT (S473), anti-AKT, anti-phospho-EGFR (Y1068), anti-EGFR, anti-phospho-ERK1/2 and anti-ERK1/2 from Cell Signaling Technology, anti-VEGF and anti-CD31 from Abcam (Cambridge, MA), and anti-β-actin from Sigma. The antibody against KLF5 has been described previously [23 (link)].
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!