γ 32p atp

Manufactured by DuPont

Sourced in United States

[γ-32P] ATP is a radioactive nucleotide used in various biochemical applications. It is a high-energy phosphate compound where the terminal phosphate group is labeled with the radioactive isotope phosphorus-32. This product is commonly used as a tracer in experimental procedures to study enzymatic reactions, DNA synthesis, and protein labeling.

Automatically generated - may contain errors

Lab products found in correlation

T4 polynucleotide kinase, by New England Biolabs (3 mentions) Hek293t cell, by American Type Culture Collection (2 mentions) Methylamine, by Merck Group (1 mentions) Bafa1, by Enzo Life Sciences (1 mentions) Apilimod, by Axon Medchem (1 mentions) Myo 2 3h inositol, by DuPont (1 mentions) Enolase, by Merck Group (1 mentions) P nitrophenyl phosphate pnpp, by Merck Group (1 mentions) Monoclonal anti β actin, by Santa Cruz Biotechnology (1 mentions) Protein a g plus agarose, by Santa Cruz Biotechnology (1 mentions) Anti erk1 2, by Cell Signaling Technology (1 mentions) Complete protease inhibitor cocktail, by Roche (1 mentions) Sirna for rev3, by Integrated DNA Technologies (1 mentions) Hek293t 17, by American Type Culture Collection (1 mentions) Polyacrylamide copolymer column, by Bio-Rad (1 mentions) Escherichia coli dh10b strain, by Thermo Fisher Scientific (1 mentions) T4 dna ligase, by New England Biolabs (1 mentions)

11 protocols using γ 32p atp

Genetic Manipulation Reagents and Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

[γ-³²P] ATP was from Du
Pont New England Nuclear (Boston, MA). KF (exo^–), EcoRV restriction endonuclease, T4 DNA ligase, T4 polynucleotide
kinase, uracil DNA glycosylase, exonuclease III, Dnase I, and Rnase
TI were obtained from New England Bioloabs (Beverly, MA). S-cdA-cyanoethyl phosphoramidite was purchased from Berry
and Associates (Dexter, MI). pMS2 plasmid and Dpo4 were gifts from
M. Moriya (SUNY, Stony Brook, NY) and Z. Suo (Ohio State University,
Columbus, OH), respectively.
The E. coli strains
used were AB1157 [F^–thr-1araC14leuB6(Am) Δ(gpt-proA)62lacY1 tsx-33 supE44(AS) galK2(Oc) hisG4(Oc) rfbD1mgl51rpoS396(Am) rpsL31(Str^r) kdgK51xylA5mtl-1argE3(Oc) thi-1], pol II^– (AB1157 but polBΔ1::Ω
Sm-Sp), pol IV^– (AB1157 but ΔdinBW2::cat), GW8017 (AB1157 but umuDC595::cat), and pol
II^–/pol IV^–/pol V^– (AB1157 but polBΔ1::Ω
Sm-Sp dinB umuDC595::cat). All E. coli strains were provided by G. Walker (MIT, Cambridge, MA).

Pednekar V., Weerasooriya S., Jasti V.P, & Basu A.K. (2014). Mutagenicity and Genotoxicity of (5′S)-8,5′-Cyclo-2′-deoxyadenosine in Escherichia coli and Replication of (5′S)-8,5′-Cyclopurine-2′-deoxynucleosides in Vitro by DNA Polymerase IV, Exo-Free Klenow Fragment, and Dpo4. Chemical Research in Toxicology, 27(2), 200-210.

+ Open protocol

+ Expand

Enzymatic Assays for DNA Polymerases

Check if the same lab product or an alternative is used in the 5 most similar protocols

[γ-³²P] ATP was from Du Pont New England Nuclear (Boston, MA). KF (exo⁻), EcoRV restriction endonuclease, T4 DNA ligase, T4 polynucleotide kinase, uracil DNA glycosylase, exonuclease III, Dnase I, and Rnase TI were obtained from New England Bioloabs (Beverly, MA). S-cdA-cyanoethyl phosphoramidite was purchased from Berry and Associates (Dexter, MI). pMS2 plasmid and Dpo4 were gifts from M. Moriya (SUNY, Stony Brook, NY) and Z. Suo (Ohio State University, Columbus, OH), respectively.
The E. coli strains used were AB1157 [F⁻thr-1 araC14 leuB6(Am) Δ(gpt-proA)62lacY1 tsx-33 supE44(AS) galK2(Oc) hisG4(Oc) rfbD1 mgl51 rpoS396(Am) rpsL31(Str^r) kdgK51 xylA5 mtl-1 argE3(Oc) thi-1], pol II⁻ (AB1157 but polBΔ1∷Ω Sm-Sp), pol IV⁻ (AB1157 but ΔdinBW2∷cat), GW8017 (AB1157 but umuDC595∷cat), and pol II⁻/ pol IV⁻/pol V⁻ (AB1157 but polBΔ1∷Ω Sm-Sp dinB umuDC595∷-cat). All E. coli strains were provided by G. Walker (MIT, Cambridge, MA).

+ Open protocol

+ Expand

Inhibitors and Tracers for Phosphoinositide Metabolism

Check if the same lab product or an alternative is used in the 5 most similar protocols

Apilimod {3-methyl-2-[6-(4-morpholinyl)-2-[2-(2-pyridinyl)ethoxy]-4-pyrimidinyl] hydrazone, benzaldehyde}, obtained from Axon Medchem LLC (USA), and YM201636 {[6-amino-N-(3-(4-(4-morpholinyl)-pyrido[3’,2’:4,5]furo[3,2-d]pyrimidin-2-yl)phenyl)-3-pyridinecarboxamide]}, purchased from Symansis NZ (Timaru, New Zealand), were used as recommended by the manufacturers. BafA1 was purchased from Enzo Life Sciences, Inc., USA. Thin layer chromatography (TLC) 20 x 20 cm glass plates (K6 silica gel 60Å, 250 μm layer thickness) and an HPLC 5-micron Partisphere SAX column were from Whatman. Methylamine (40% w/w solution in water), n-propoanol and tetrabutylammonium bisulfate (TBAS) were from Sigma-Aldrich, USA. Glucose- and inositol-free DMEM was prepared in house in sterile distilled deionized water from amino acids and vitamins purchased from Gibco Laboratories (Life Technologies, Inc., USA) or Sigma (Sigma-Aldrich, USA), and inorganic salts from various commercial sources. [γ-³²P]ATP (6000 Ci/mmol) and myo-[2-³H]inositol (22.5 Ci/mmol) were from NEN Du-Pont (Boston, MA) and Perkin Elmer (Boston, MA), respectively. Natural soybean PtdIns was from Avanti Polar Lipids, Inc. (USA). Polyclonal anti-PIKfyve antibody was previously described [39 (link)]. Goat polyclonal anti-early endosomal antigen 1 (EEA1) antibodies (N-19) were from Santa Cruz Biotechnology (Santa Cruz, CA).

Sbrissa D., Naisan G., Ikonomov O.C, & Shisheva A. (2018). Apilimod, a candidate anticancer therapeutic, arrests not only PtdIns(3,5)P2 but also PtdIns5P synthesis by PIKfyve and induces bafilomycin A1-reversible aberrant endomembrane dilation. PLoS ONE, 13(9), e0204532.

+ Open protocol

+ Expand

Antibody Panel for Protein Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used the following antibodies: polyclonal anti-STEP, anti-Pyk2 (pY402), anti-ERK1/2 (pT202/pY204), and anti-ERK1/2 from Cell Signaling Technology (Danvers, MA, USA); polyclonal anti-Pyk2, monoclonal anti-β-actin, and polyclonal anti-fyn from Santa Cruz Biotechnology (Santa Cruz, CA, USA); monoclonal anti-v-src (Ab1, clone 327) from Calbiochem (EMD Chemical, Merck, Darmstadt, Germany); polyclonal anti-GluN2B (pY1472), anti-GluN2B, and monoclonal anti-phosphotyrosine (pY, clone 4G10) from Millipore Bioscience Research Reagent (Billerica, MA, USA); and peroxidase-conjugated goat anti-mouse and goat anti-rabbit from Bio-Rad (Hercules, CA, USA). Protein A/G PLUS agarose was from Santa Cruz Biotechnology and Trysacryl-immobilized protein A from Thermo Scientific (Waltham, MA, USA). Nitrocellulose was from Schleicher and Schuell Bioscience Inc. (Dassel, Germany); p-nitrophenyl phosphate (p-NPP) and enolase were from Sigma Chemical (St. Louis, MO, USA). Complete protease inhibitor cocktail was from Roche Diagnostics (Basel, Switzerland). [γ³²P] ATP (>3000 Ci/mmol) was obtained from DuPont NEN (Boston, MA, USA).

Mallozzi C., Spalloni A., Longone P, & Domenici M.R. (2018). Activation of Phosphotyrosine-Mediated Signaling Pathways in the Cortex and Spinal Cord of SOD1G93A, a Mouse Model of Familial Amyotrophic Lateral Sclerosis. Neural Plasticity, 2018, 2430193.

+ Open protocol

+ Expand

Radiometric DNA Glycosylase Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA glycosylase assays were conducted as previously described [2 (link), 60 (link)] on a G:U mismatched substrate obtained by annealing the oligonucleotides CAATCCTAGCTGACACGATGTGGCCAATGGCATGACT and GAGTCATGCCATTGGCCACATUGTGTCAGCTAGGATT [61 (link)], in which the latter was radiolabeled at the 5′ end with T4 polynucleotide kinase (New England Biolabs) and γ-³²P-ATP (NEN Dupont). The reactions, containing vehicle or candidate inhibitors at increasing concentrations, were incubated at 37 °C for 30’ and then treated with NaOH at 90 °C for 30’ to cleave the abasic site. Substrate and product bands were separated by 8.3 M urea/25% polyacrylamide gel electrophoresis and exposed to autoradiography.

Mancuso P., Tricarico R., Bhattacharjee V., Cosentino L., Kadariya Y., Jelinek J., Nicolas E., Einarson M., Beeharry N., Devarajan K., Katz R.A., Dorjsuren D.G., Sun H., Simeonov A., Giordano A., Testa J.R., Davidson G., Davidson I., Larue L., Sobol R.W., Yen T.J, & Bellacosa A. (2019). Thymine DNA glycosylase as a novel target for melanoma. Oncogene, 38(19), 3710-3728.

+ Open protocol

+ Expand

DNA Glycosylase Assay Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA glycosylase assays were conducted as previously described^{2 (link), 60 (link)} on a G:U mismatched substrate obtained by annealing the oligonucleotides CAATCCTAGCTGACACGATGTGGCCAATGGCATGACT and GAGTCATGCCATTGGCCACATUGTGTCAGCTAGGATT^{61 (link)}, in which the latter was radiolabeled at the 5′ end with T4 polynucleotide kinase (New England Biolabs) and γ−³²P-ATP (NEN Dupont). The reactions, containing vehicle or candidate inhibitors at increasing concentrations, were incubated at 37°C for 30’, and then treated with NaOH at 90°C for 30’ to cleave the abasic site. Substrate and product bands were separated by 8.3 M urea/25% PAGE and exposed to autoradiography.

+ Open protocol

+ Expand

Molecular Cloning and Cell Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

[γ-³²P]ATP was purchased from Du Pont New England Nuclear (Boston, MA). All enzymes, including EcoRV restriction endonuclease, T4 DNA ligase, T4 polynucleotide kinase, uracil DNA glycosylase, and exonuclease III, were obtained from New England Bioloabs (Beverly, MA). HEK293T cells were purchased from the American Type Culture Collection (Manassas, VA). E. coli DH10B cells was purchased form Life Technologies, Inc. (Grand Island, NY)
siRNAs: Synthetic siRNA duplexes against POLH (SI02663619), POLK (SI04930884), POLI (SI03033310), REV1 (SI00115311), and All Stars negative control siRNA (1027280) were purchased from Qiagen (Valencia, CA). The siRNA for REV3 was purchased from Integrated DNA Technologies (Coralville, IA). Sequences of the siRNAs are listed in Table S1 of the Supporting Information.

Weerasooriya S., Jasti V.P., Bose A., Spratt T.E, & Basu A.K. (2015). Roles of Translesion Synthesis DNA Polymerases in the Potent Mutagenicity of Tobacco-Specific Nitrosamine-Derived O2-Alkylthymidines in Human Cells. DNA repair, 35, 63-70.

+ Open protocol

+ Expand

Radiolabeled ATP Biochemical Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

All starting materials, reagents, and solvents
were of commercial grade and used as such unless otherwise specified.
[γ-³²P]ATP was from Du Pont New England Nuclear (Boston,
MA). EcoRV restriction endonuclease, T4 DNA ligase,
T4 polynucleotide kinase, uracil DNA glycosylase, and exonuclease
III were obtained from New England Bioloabs (Beverly, MA). Plasmid
pMS2 was a gift from M. Moriya (Stony Brook University, The State
University of New York, Stony Brook, NY). HEK293T/17 and COS-7 cells
were purchased from the American Type Culture Collection (Manassas,
VA).

Pande P., Malik C.K., Bose A., Jasti V.P, & Basu A.K. (2014). Mutational Analysis of the C8-Guanine Adduct of the Environmental Carcinogen 3-Nitrobenzanthrone in Human Cells: Critical Roles of DNA Polymerases η and κ and Rev1 in Error-Prone Translesion Synthesis. Biochemistry, 53(32), 5323-5331.

+ Open protocol

+ Expand

HSE Oligonucleotide Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A double-stranded HSE (5′GCCTCGAATGTTCGCGAAGTT3′) consensus sequence was used for EMSA (24 (link)). End-labeling was accomplished by treatment with T4 polynucleotide kinase in the presence of γ³²P-ATP (Dupont-NEN). Labeled oligonucleotide was purified on a polyacrylamide copolymer column (Bio-Rad Laboratories). Nuclear protein (5 μg) was added to a binding reaction mixture containing 20 mM HEPES (pH 7.9), 50 mM KCl, 0.1 mM EDTA, 1 mM DTT, 5% glycerol, 200 μg/ml BSA, 2 μg polydeoxyinosinic:polydeoxycytidylic acid. Samples were incubated at room temperature for 20 min followed by incubation with 50,000 cpm γ³²P-labeled HSE oligonucleotide for 10 minutes. For the cold competition reaction, a 20-fold excess of a specific, unlabeled, double-stranded probe was added to the reaction mixture 30 minutes before adding the labeled oligonucleotide. All reactions were run on a 4% polyacrylamide gel, and the dried gel was exposed to X-ray film at −80°C.

Muralidharan S., Ambade A., Fulham M.A., Deshpande J., Catalano D, & Mandrekar P. (2014). Moderate alcohol induces stress proteins HSF1 and hsp70 and inhibits pro-inflammatory cytokines resulting in endotoxin tolerance,. Journal of immunology (Baltimore, Md. : 1950), 193(4), 1975-1987.

+ Open protocol

+ Expand

Radiolabeled DNA Cloning Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

[γ-³²P]ATP was from Du Pont New England Nuclear (Boston, MA). T4 DNA ligase and T4 polynucleotide kinase were obtained from New England Biolabs (Beverly, MA). Escherichia coli strain DH10B was purchased from Invitrogen (Carlsbad, CA). HEK 293T cells were obtained from ATCC (Manassas, VA). Single-stranded phagemid pMS2 DNA was prepared from E. coli JM109 with the aid of the helper phage M13K07 (NEB, Beverly, MA) as reported by Moriya [30] (link).

Weerasooriya S., Jasti V.P, & Basu A.K. (2014). Replicative Bypass of Abasic Site in Escherichia coli and Human Cells: Similarities and Differences. PLoS ONE, 9(9), e107915.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!