Myocilin

Cells were cultured on coverslips and fixed with 4% paraformaldehyde. Cell permeabilization was achieved using 0.1%Triton X-100 incubation for 20 minutes and blocking with 1% BSA for one hour. Cells were treated overnight at 4°C with primary antibodies for OCT4-FITC (SantaCruz Bioscience), alkaline phosphatase-PE, SSEA4-APC (eBioscience), SSEA1-PerCP (Biolegend), HNK1-PECY7 (Invitrogen), NGFR-APC (BD Pharmingen), CHI3L1 (R&D Systems), and myocilin (SantaCruz). Phalloindin-555 was used to stain F-actin and DAPI was employed as a nuclear stain and samples were acquired using laser scanning confocal microscope (Olympus).
Real-time PCR:
RLT buffer was used for lysis of cultured cells and an RNA purification kit (RNeasy Mini Kit, Qiagen) was used for isolation of total RNAs. RNAs were reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). SYBR green (Applied Biosystems) chemistry was used for qPCR. Primer3 was used to design primers for Housekeeping gene 18S rRNA (Forward: CCCTGTAATTGGAATGAGTCCAC, Reverse: GCTGGAATTACCGCGGCT), myocilin (forward: AAGCCCACCTACCCCTACAC; reverse: TCCAGTGGCCTAGGCAGTAT), CHI3L1 (forward: CCTTGACCGCTTCCTCTGTA; reverse: GTGTTGAGCATGCCGTAGAG), ANGPTL7 (forward: GCACCAAGGACAAGGACAAT; reverse: GATGCCATCCAGGTGCTTAT).