Fluorescein tagged antisense MO oligonucleotides targeting the 5′UTR of gpr22 RNA and a control MO were obtained from Gene Tools, LLC (MO1: 5′-TCCCCTCCCTTGTGTTCCCTGTCCT-3′ ; MO2: 5′-ACTCCATCCATACTCCAATGCCTCT-3′ ; control MO: 5′-GGATTAAAATCCGCTACTCACATCC-3′ ; p53 MO: 5′-GCGCCATTGCTTTGCAAGAATTG-3′ ). Unless specified otherwise in the Results, 0.2 mM MO1 together with 0.1 mM p53 MO, or 0.4 mM MO2 were injected into the yolk of one cell stage embryos in a volume of 1 nl. To target MOs specifically to the dorsal forerunner cells (DFCs), 1 mM of MO was injected into the yolk at mid-blastula stage as previously described [32] (link). After injection, embryos with fluorescent-MO positive DFCs were selected at the 1–5 somite stage for further analysis.
Control mo
Manufactured by Gene Tools
Sourced in United States
Control-MO is a laboratory tool designed to serve as a negative control for morpholino-based gene knockdown experiments. It is a synthetic oligonucleotide that does not target any known gene sequence.
Automatically generated - may contain errors
Lab products found in correlation
Snrnp200 mo, by Gene Tools (2 mentions)
Pli 100 picolitre injector, by Harvard Apparatus (1 mentions)
Opti mem 1, by Thermo Fisher Scientific (1 mentions)
Femtojet, by Eppendorf (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Morpholino, by Gene Tools (1 mentions)
P53 mo, by Gene Tools (1 mentions)
Adenosine triphosphate (atp), by Merck Group (1 mentions)
Tp53 mo, by Gene Tools (1 mentions)
Q5 mutagenesis, by New England Biolabs (1 mentions)
Sp6 mmessage mmachine, by Thermo Fisher Scientific (1 mentions)
Mmessage mmachine sp6 kit, by Thermo Fisher Scientific (1 mentions)
Ksom medium, by Merck Group (1 mentions)
Mmessage mmaschine system, by Thermo Fisher Scientific (1 mentions)
Phenol red, by Merck Group (1 mentions)
28 protocols using control mo
1
Knockdown of gpr22 RNA in Zebrafish
2
Morpholino Knockdown of Mcm10 in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mcm10 morpholino oligonucleotide (MO) and control MO were purchased from GeneTools (Philomath, OR). MO efficiency was tested by reverse transcription polymerase chain reaction (RT-PCR) of total RNA extracted from ∼15 embryos at 28 hpf. In all experiments, 8 ng of mcm10-MO was injected per embryo. Morpholinos and primer sequences were as follows: standard control MO CCTCTTACCTCAGTTACAATTTATA, Mcm10-MO CAGATATGCTGCTCCATTACATTGT, forward GAGACGGTGCTAAAGTGAAC (exon 4), and reverse CTTCCACAGGTCAGTGTGAA (exon 6).
3
Optimizing Zebrafish Gene Knockdown via Morpholinos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard control morpholino oligos (control-MO: 5′-CCTCTTACCTCAGTTACAATTTATA-3′) and zebrafish Snrnp200 splicing-blocking MO targeting exon 25 (Snrnp200-MO: 5′-TCAACATCAAGACAACTCACATCCT-3′) were purchased from Gene Tools (Philomath, OR, USA). MO has been widely used to interfere in the transcription or translation of a targeted gene resulting in loss-of-function of the gene [19 (link), 20 (link)]. Zebrafish embryos were injected at the 1- or 2-cell stage (0 day postfertilization (dpf)) with ~1 nL of purified MOs dissolved in water. To get the best adjusted dosage for Snrnp200-MO, zebrafish embryos were divided into three groups and injected with 2 (n = 67), 4 (n = 68), and 8 ng (n = 65) of MOs, respectively. Another two groups were further obtained and were injected with control-MO (4 ng; n = 72) and Snrnp200-MO (4 ng; n = 68), respectively. The counting and the percentage calculation of deformation and death in each injected group were conducted from 2 to 4 dpf as described previously [12 (link)]. Embryos that died within 24 hr postfertilization were excluded because such death likely resulted from unspecific causes. At 4 dpf, embryos with relatively normal appearance were collected from each injected group for further investigations.
4
Knockdown of Zebrafish F8 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ZF F8 protein shares 30.5% identity (51.3% similarity) in a 2361 amino acid overlap with human FVIII. The morpholino oligomer (MO) sequence, which blocks protein translation, was designed to knock down the expression of endogenous F8. A standard control MO (Control-MO, Gene Tools) was used as a negative control. The MO sequences were as follows: 5′-TTTACAATATCCTCACTCACTGTGC-3′ (f8-MO) and 5′-CCTCTTACCTCAGTTACAATTTATA-3′ (Control-MO). ZF were microinjected with MO diluted to concentrations of 0.5, 0.75, and 1.00 mM at the 1-cell stage or at 48 hours after fertilization using a PLI-100 Picolitre injector (Harvard Apparatus), as previously described.19
5
Snail1 Knockdown Impairs Lung Metastasis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Snail1 Vivo-morpholino (Snail1-MO) (5′-TGAACTCTGCGGGAAGAGAAGAGAC-3′) against the boundary sequences of the intron 1 and exon 2 of Snail1 gene and standard control morpholino (Control-MO) that targets human β-globin intron mutation (5′-CCTCTTACCTCATTACAATTTATA-3′) were designed (by Gene Tools). C57BL/6 mice aged 7 weeks were injected in the tail vein with BrafV600E-5555 -Luciferase cells. 10 dpi, a solution containing Snail1-MO or Control-MO in saline (100 μl; 6 mg MO per kg) was injected in the tail vein of the corresponding mice every other day. After 20 days mice were sacrificed and lungs were processed, sectioned, and subjected to analysis.
6
Morpholino-based Knockdown and Rescue Assay for Mef2c and Mef2d in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All MOs were purchased from Gene Tools, LLC, OR USA, resuspended in DEPC-H2O and stored as aliquots at −20°C. Mef2cMO: 5′-CCA TAG TCC CCG TTT TTC TGT CTT C-3′ ; Mef2dMO: ′-AAT CTG GAT CTT TTT TCT GCC CAT G-3′ 5. For knock down approaches, we injected the MOs (10 ng) into both dorso-vegetal blastomeres of eight-cell embryos to target the presumptive heart region [27] (link). For lineage labeling and to identify the injected side, we co-injected 0.5 ng GFP RNA. Only correctly injected embryos were considered for the experiments. For control injection experiments, the standard Control MO of Gene Tools was used. Control MO: 5′-CCT CTT ACC TCA GTT ACA ATT TAT A-3′ For rescue experiments, mRNA (0.5 ng) was injected together with MO. The binding specificity of MOs was tested in vivo were cloned in frame with and in front of the GFP open reading frame in pCS2+. The indicated RNA and MO were co-injected bilaterally into two-cell stage embryos and GFP translation was monitored at stage 20 using a fluorescence microscope.
7
Zebrafish Embryo Microinjection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Snrnp200-MO (5′-TCAACATCAAGACAACTCACATCCT-3′) and Control-MO (5′-CCTCTTACCTCAGTTACAATTTATA-3′) were designed as previously described and purchased from Gene Tools, LLC (Philomath, Oregon, USA).
Embryos at 1 cell-stage were chosen for microinjections in the morning. For mRNA microinjection, each embryo was injected with 1 nL solution containing 200 pg SNRNP200WT or SNRNP200c.C6088T mRNA. For co-injections of MO and mRNA, zebrafish embryos were separated into four groups and were injected with 4 ng Control-MO, 4 ng Snrnp200-MO, 4 ng Snrnp200-MO plus 200 pg SNRNP200WT mRNA, and 4 ng Snrnp200-MO plus 200 pg SNRNP200c.C6088T mRNA, respectively. During the entire experiment, the embryos that died within 24 h postoperatively were eliminated, as it was likely that they died from indefinite causes. The percentage of deformation and mortality of zebrafish embryos was calculated from 2 to 3 dpf.
Embryos at 1 cell-stage were chosen for microinjections in the morning. For mRNA microinjection, each embryo was injected with 1 nL solution containing 200 pg SNRNP200WT or SNRNP200c.C6088T mRNA. For co-injections of MO and mRNA, zebrafish embryos were separated into four groups and were injected with 4 ng Control-MO, 4 ng Snrnp200-MO, 4 ng Snrnp200-MO plus 200 pg SNRNP200WT mRNA, and 4 ng Snrnp200-MO plus 200 pg SNRNP200c.C6088T mRNA, respectively. During the entire experiment, the embryos that died within 24 h postoperatively were eliminated, as it was likely that they died from indefinite causes. The percentage of deformation and mortality of zebrafish embryos was calculated from 2 to 3 dpf.
8
Knockdown and Overexpression of Rab5c and Rin2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For MO-mediated gene knockdown, embryos were injected at the one-cell stage with 3 ng control MO (Gene Tools), 5′-CCTCTTACCTCAGTTACAATTTATA-3′, 3 ng rab5c MO, 5′-CGCTGGTCCACCTCGCCCCGCCATG-3′ 3 ng rin2 MO, 5′-GCAGTGTGTTTTAACTCTCACCTTA-3′. Sequence of the rab5c ATG MO was as previously described [37 (link)]. The rab5c and rin2 splice-site MOs were generated as shown (Fig. S6A,S8A), and validated by RT-PCR. For mosaic overexpression of mCherry-WT-Rab5C or mCherry-DN-Rab5C, embryos were injected at the single-cell stage with 100 pg plasmid and 250 pg Tol2 mRNA per embryo. Effects on vascular development were analyzed at 30–32 hpf.
9
Morpholino Administration in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Morpholinos (MOs) were designed and synthesized by Gene Tools LLC (Philomath, OR, USA). The MO sequences are shown in Additional file 2 : Table S2. For the negative control groups, the control MO (human β-globin mutant sequence; GeneTools) was used. Intraperitoneal (i.p.) administration of Morpholinos was conducted as previously described [26 ]. In detail, 2 μl samples of each MO solution were diluted by adding 3 μl of OPTI-MEM I (Life Technologies), which was combined with a Lipofectamine 2000 (Life Technologies) mixture (2 μl of Lipofectamine 2000 and 3 μl of OPTI-MEM I). The MO mixtures were incubated at room temperature for 20 min and injected into the abdominal cavity of 3–4 mpf zebrafish (approximately 50 μmol/kg body weight) using FemtoJet (Eppendorf, Hamburg, Germany) with a fine-polished GD-1 glass capillary (Narishige, Tokyo, Japan). Intraperitoneal administration was conducted once a week during feeding experiments, starting from 1 week before the feeding experiment.
10
Dnd Morpholino Knockdown in Zebrafish
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!