Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA), and the reverse transcription was performed using uni all-in-One first-strand cDNA synthesis super-Mix for qPCR (Trans-Script, Beijing, China) according to the producer’s recommendations. Real-time PCR was performed in triplicate by SYBR Green fluorescent-based assay (638320, TaKaRa Bio Inc.) on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA). The primers for real-time PCR were listed as follows: MTFR2: Forward:5′-ATTTTGGCGTTCCTGTAGAACA-3′; Reverse: 5′-CAGAGTTCAAGAGCGGGATCA-3′; GAPDH: Forward:5′-CTGGGCTACACTGAGCACC-3′; Reverse:5′-AAGTGGTCGTTGAGGGCAATG-3′; Relative mRNA expression levels were calculated by the 2− (Δ Δ Ct) [Δ Ct = Ct (targeting gene)-Ct (GAPDH)] method and were normalized to the internal control of GAPDH.
Sybr green fluorescent based assay
Manufactured by Takara Bio
Sourced in Japan
SYBR Green is a fluorescent-based assay that binds to double-stranded DNA. It can be used to quantify the amount of DNA present in a sample.
Automatically generated - may contain errors
Lab products found in correlation
9 protocols using sybr green fluorescent based assay
1
Quantitative Real-Time PCR for Gene Expression
2
Quantifying mRNA Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tumour tissue or cells by Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. qRT‐PCR was performed in triplicate using SYBR Green fluorescent‐based assay (TaKaRa Bio Inc., Otsu, Japan). Relative mRNA expression levels were calculated based on the threshold cycle (Ct) values as: 2−ΔCt [ΔCt = Ct (targeting gene)–Ct (GAPDH)] and were normalized. The relative RNA expression levels were calculated with the 2−ΔΔCt method and normalized to the internal control of GAPDH. The primer sets are listed in Table S2 .
3
Quantitative Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol Reagent (Invitrogen) and the cDNA was synthetized using the PrimeScript™ Kit (TaKaRa Bio Inc., Otsu, Japan) following the manufacturer’s instructions. qRT-PCR was performed in triplicate using SYBR Green fluorescent-based assay (TaKaRa Bio Inc.) on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA). The primers for real-time PCR were listed as follows: E-cadherin Forward: 5′-TACGCCTGGGACTCCACCTA-3′, Reverse: 5′-CCAGAAACGGAGGCCTGAT-3′; Vimentin Forward: 5′-TGTGGATGT TTCCAAGCCTGAC-3′, Reverse: 5′-GAGTGGGTATCAACCAGAGGGAG-3′; N-cadherin Forward: 5′-CCACGCCGAGCCCCAGTATC-3′, Reverse: 5′-CCCCCA GTCGTTCAGGTAATCA-3′; Snail Forward: 5′-CACTATGCCGCGCTCTTTC-3′, Reverse: 5′-GCTGGAAGGTAAACTCl′GGATTAGA-3′; GAPDH Forward: 5′-CGG AGTCAACGGATTTGGTCGTAT-3′, Reverse: 5′-AGCCTTCTCCATGGTGGTGA AGAC-3′; Slug Forward: 5′-GGGCTCAGTTCGTAAAGG-3′, Reverse: 5′-GAGGAGGTGTCAGATGGA-3′; Twist Forward: 5′-TTTACATCCGATTTACTGC-3′, Reverse: 5′-CCTAATGCTTTCCCTCAT-3′; Zeb1 Forward: 5′-AAGTGGCGGTAGATGGTA-3′, Reverse: 5′-TTGTAGCGACTGGATTTT-3′. Relative mRNA expression levels were calculated by the 2−ΔCt [ΔCt = Ct (targeting gene)-Ct (GAPDH)] method and were normalized to the internal control of GAPDH.
4
Quantitative real-time PCR analysis protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cell lines was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's guidelines. A total of 500 ng RNA was converted into cDNA using the PrimeScript™ kit (Takara Bio, Inc.) under the following conditions: 37°C for 15 min, 85°C for 5 sec, and were held at 4°C. Quantification of target genes and the reference gene (GAPDH) was studied in triplicate on the ABI-7500 system (Applied Biosystems, Inc.; Thermo Fisher Scientific, Inc.) using SYBR-Green fluorescent-based assay (Takara Bio Inc.). The reaction conditions were as follows: Pre-denaturation at 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 34 sec. The primers used were as follows: DHRS2 forward, 5′-TCACAGAAAGCCTAGCACAG-3′ and reverse, 5′-TGAGACCATCACCAAGCG-3′; GAPDH forward, 5′-GCACCGTCAAGGCTGAGAAC-3′ and reverse, 5′-TGGTGAAGACGCCAGTGGA-3′; ERCC1 forward, 5′-CTCAAGGAGCTGGCTAAGATGT-3′ and reverse, 5′-CATAGGCCTTGTAGGTCTCCAG-3′; vimentin forward, 5′-TGAGTACCGGAGACAGGTGCAG-3′ and reverse, 5′-TAGCAGCTTCAACGGCAAAGTTC-3′; and E-cadherin forward, 5′-TACACTGCCCAGGAGCCAGA-3′ and reverse, 5′-TGGCACCAGTGTCCGGATTA-3′. The quantification was based on ΔΔCq calculations (24 (link)) and was normalized to GAPDH as a loading control.
5
Quantifying Gene Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative mRNA levels were assessed by quantitative reverse transcription PCR (qRT-PCR) [38 (link)]. After Trizol (Invitrogen, Carlsbad, CA) treatment, all RNAs of the liver tissues were obtained and the Prime Script Kit (TaKaRa Bio Inc., Japan) was performed for cDNA synthesis. qRT-PCR was performed on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA) using SYBR Green fluorescent-based assay (638320, TaKaRa Bio Inc. Japan). The β-actin gene was used as an internal standard and after normalizing to its expression level, the relative expression levels of α4nAChR, α7nAChR, and α-SMA were quantified by the 2−ΔΔCt method [39 (link)]. The reaction parameters were set as 50°C for 2 min, 95°C for 15 s, 95°C for 15 s, and 60°C for 1 min for 40 cycles. The primers of target genes were synthesized by Sinaclon (Tehran, Iran) and reported in Table 1 .
6
Quantitative RT-PCR Analysis of Oncogene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA), and amplification of the cDNA (1 µg per sample) was performed using the Prime Script Kit (TaKaRa Bio Inc., Otsu, Japan) according to the manufacturer's indication. Real‐time PCR was performed in triplicate by SYBR Green fluorescent‐based assay (638320, TaKaRa Bio Inc.) on a ViiATM7 RT‐PCR system (Applied Biosystems, Carlsbad, CA). The primers for real‐time PCR were as follows: MLH1: forward: 5′‐CTCCAAGATGAGGCTGTAGGAA‐3′; reverse: 5′‐CCTATGAGATGGAAGGCAAGA‐3′; GAPDH forward: 5′‐CTGGGCACTGAGCACC‐3′; reverse: 5′‐AAGTGGTCGTTGAGGGCAATG‐3′; Her‐2 forward: 5′‐GATCCCCTGATAGACACCAACCGCTCTTCAAGAGAGAGCGGTTGGTGTCTATCATTTTTGGAAA‐3′; reverse: 5′‐AGCTTTTCCAAAAATGATAGACACCAACCGCTCTCTCTTGAAGAGCGGTTGGTGTCTATCAGGG‐3′; PI3K forward: 5′‐TGCTATGCCTGCTCTGTAGTGGT‐3′; reverse: 5′‐GTGTGACATTGAGGGAGTCGTTG‐3′; and AKT forward: 5′‐GTGCTGGAGGACAATGACTACGG‐3′; reverse: 5′‐AGCAGCCCTGAAAGCAAGGA‐3′. Relative mRNA expression levels were calculated by the 2−(ΔΔCt) method and were normalized to the internal control (GAPDH), ΔCt = Ct (targeting gene) − Ct (GAPDH), and ΔΔCt = ΔCt (treated) – ΔCt (control).
7
SYBR Green-based qRT-PCR for mRNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA expression was quantitatively analyzed using the SYBR Green fluorescent-based assay (TaKaRa Bio Inc., Otsu, Japan). The primers for real-time PCR are listed in Additional file 1 : Table S1. The relative mRNA expression levels of target genes were normalized to the internal control of GAPDH.
8
Quantification of BMP4, JNK1 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol Reagent (15596018, Invitrogen, Carlsbad, CA) and the cDNA (1 μg per sample) was synthetized using the PrimeScript™ Kit (RR037A, TaKaRa Bio Inc., Otsu, Japan) according to the manufacturer’s protocols. qRT-PCR was performed in triplicate by SYBR Green fluorescent-based assay (638320, TaKaRa Bio Inc.) on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA). The primers for real-time PCR were listed as follows: BMP4 Forward: 5’-CTCCAAGAATGGAGGCTGTAGGAA-3′; Reverse: 5’-CCTATGAGATGGAGCAGGCAAGA-3′; GAPDH Forward: 5’-CTGGGCTACACTGAGCACC-3′; Reverse: 5’-AAGTGGTCGTTGAGGGCAATG-3′; JNK1 Forward: 5’-TCTGGTATGATCCTTCTGAAGCA-3′; Reverse: 5’-TCCTCCAAGTCCATAACTTCCTT-3′. Relative mRNA expression levels were calculated by the 2-ΔCt [ΔCt = Ct (targeting gene)-Ct (GAPDH)] method and were normalized to the internal control of GAPDH.
9
Quantitative Analysis of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total mRNA expression was quantitatively analysed using the SYBR Green fluorescent-based assay (TaKaRa Bio, Otsu, Japan). The RT-PCR assays were performed using glyceraldehyde 3-phosphate dehydrogenate (GAPDH) as an internal control. Independent experiments were repeated three times for each sample, and the relative gene expression levels were analysed using the 2-ΔΔCT method. The primers, which were designed by Sangon Biotech (Shanghai), were as follows: For HMGB1: forward 5′-TATGGCAAAAGCGGACAAGG-3′ and reverse 5′-CTTCGCAACATCACCAATGGA-3′ For GAPDH: forward 5′-GAGAGGGAAATCGTGCGTGAC-3′ and reverse 5′-CATCTGCTGGAAGGTGGACA-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!