Brilliant 2 sybr green qpcr master mix

A total of 20 stage-enriched genes were selected for validation using qRT-PCR as described [29 (link)]. One microgram total RNA samples were reverse transcribed into first-strand cDNA using a SuperScript III Reverse Transcriptase Kit (Invitrogen, Carlsbad, CA, USA) with oligo (dT) 15 primer. The cDNA products were diluted 20-fold with nuclease-free water before undertaking the qPCR. Each 25 μl PCR reaction contained 12.5 μl of 2 × Brilliant II SYBR Green QPCR Master Mix (Agilent, USA), 1 μl cDNA, 1 μl of the forward and reverse primer pair (Additional file 2: Table S1), and 10.5 μl of sterile water. PCR cycling conditions were as follows: 95 °C for 10 min, followed by 40 cycles of 30 s denaturation at 95 °C and 1 min annealing and extension at 60 °C. A dissociation step (95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s and 60 °C for 15 s) was performed to confirm the amplification specificity for each gene. 26S proteasome non-ATPase regulatory subunit 4 (PSMD4) [29 (link), 40 (link)] was employed as a house-keeping gene in the assays. PCR reactions were performed in technical triplicates on the 7300 Real-Time PCR system (Applied Biosystems). The relative expression level of each gene was analysed using SDS 1.4 software (Applied Biosystems). Correlations between the microarray and qPCR results for 20 stage-enriched genes were analysed with the Spearman’s rho.

Quantitative (q) PCR was carried out with a Stratagene Mx3000P detector system (Agilent Technologies) with optic tubes (SSI Innovations for Life Science) using 2× Brilliant II SYBR® Green qPCR Master Mix (Agilent Technologies). Four technical replicates were performed for rprml MO-injected embryos and three were performed for uninjected control embryos. actb1 was used as reference gene in all qRT-PCR reactions. actb1 forward primer (5′-3′) = TGAGCAGGAGATGGGAACC, and reverse primer (5′-3′) = CAACGGAAACGCTCATTGC (product size 102 base pairs -bps-). p53 forward primer (5′-3′) = CAGTCTGGCACAGCAAAATC, and reverse primer (5′-3′) = TTTGCCAGCTGACAGAAGAG (product size 74 bps). Gene expression data was processed by MxPro qPCR Software 4.10. Relative p53 expression levels in rprml MO-injected embryos and controls are expressed as ΔCq values: $\mathrm{\Delta }\mathrm{Cq}=\mathrm{Cq}(\mathrm{reference})–\mathrm{Cq}(\mathrm{target})$ . Graphical representation of the data are shown as mean ΔCq ± (SEM). All relevant qPCR data are available in the supplementary material (Supplementary Table 1).

Total RNAs of S. japonicum at different developmental stages (cercariae, hepatic schistosomula, separated male and female adult worms, and eggs) were extracted using Trizol reagent (Invitrogen, CA, USA). The possible contaminating genomic DNA was completely removed from RNA samples with TURBO DNA-free kit (Ambion, CA, USA). RNA quantification and quality control was conducted by 1% agarose gel electrophoresis and the Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE). For each sample, 1 µg total RNA was reverse transcribed into first-strand cDNA using SuperScript III Reverse Transcriptase Kit (Invitrogen). The synthesis procedure was performed as follows: 25°C for 5 min, 50°C for 1 h, 70°C for 15 min. Each PCR reaction contained 12.5 µl of 2×Brilliant II SYBR Green QPCR Master Mix (Agilent, USA), 1 µl diluted cDNA (20×), 1 µl of the forward and reverse primer pair (Table S1), and 10.5 µl of sterile water. The PCR program included 40 cycles with denaturation at 95°C for 30 s, followed by annealing and extension at 60°C for 1 min. Quantification of the transcriptional level of the SjScrib gene was performed by normalizing against the PSMD4 transcript (26S proteasome non-ATPase regulatory subunit 4, GenBank Accession Number: FN320595) [52] (link), [53] (link) and applying the comparative 2^−ΔΔCt method, according to the SDS 1.4 software.

The abundance of Asaia was assessed in duplicate using quantitative polymerase chain reaction (qPCR). The AsaH1_F and Asar_R primers were used to quantify the symbiont in each DNA template (Table S1). qPCR of Ribosomal Protein S7 (single copy gene) of both species (VectorBase ID: AFUN007153 in An. funestus; orthologous to An. gambiae: AGAP010592) was performed in parallel to normalize the Asaia load (Table S1). The reactions were run in a total volume of 10 μL, containing 5 μL of 2X Brilliant II SYBR^® Green QPCR Master Mix (Agilent), 1 µM of each primer, 1 μL of nuclease-free water, and 2 μL template DNA. The reactions were run on an MX3005 real-time PCR system (Agilent) following a dissociation curve (95 °C for 10 s, 65 °C for 60 s, and 97 °C for 1 s [40 (link)]. The standard curve of each gene was generated by diluting one-tenth of the DNA extracted from Asaia cultures and the purified PCR amplicons of the ribosomal protein S7 gene. Ct values of >35 were considered uninfected or undetectable. The normalized amount of bacterial DNA was estimated by the relative ratio of Asaia gene copy numbers to RSP-7 gene copy numbers. Mann Whitney and Kruskal Wallis non-parametric tests were used to compare the load of Asaia spp. between phenotype (alive and dead) and genotype, respectively, via GraphPad Prism 8.2.0.

PBMCs were cocultured with VZV infected ARPE-19s for 4 hours, as detailed above. Cells were harvested, stained for FACS sorting, and CD3^–CD56⁺ NK cells isolated. Throughout the staining and sorting process cells were kept at 4°C or on ice. Following the NK cell isolation, 1 x 10⁵ cells were harvested by washing in PBS and the cell pellet frozen at –80°C. The remaining NK cells were cultured in complete RPMI medium at 37°C with 5% CO₂ in a 96-well plate, and harvested at the specified time points. Subsequently, DNA was extracted with the QIAamp DNA Mini Kit (QIAGEN), following the protocol for cultured cells. DNA was amplified by qPCR (LightCycler 480 II, Roche) using 2X Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies) at 50°C for 2 mins and then 50 cycles of 95°C for 15 secs and 60°C for 45 secs, using the following primers: ORF28 forward, CGAACACGTTCCCCATCAA; ORF28 reverse, CCCGGCTTTGTTAGTTTTGG; Albumin forward, TTTGCAGATGTCAGTGAAAGAGA; Albumin reverse, TGGGGAGGCTATAGAAAATAAGG [86 (link)]. Relative viral genome copies were determined by normalising ORF28 levels to Albumin, and values were depicted as fold change over the initial time point (4 hpi).

β-ACTIN and GAPDH (glyceraldehyde 3-phosphate dehydrogenase) were selected as housekeeping genes based on previous analyses from our laboratory that demonstrated high stability in the bfMSC cultures (4 (link), 6 (link)). Primers were designed using the PrimerExpress software (Applied Biosystems Incorporated, Foster City, CA, USA) (Table 1). Equivalence of amplification efficiencies among all primer-probe sets was confirmed using serial 3-fold dilutions of AT-MSC cDNA. Each PCR reaction (10 μL) contained the following: 2X Brilliant II SYBR Green QPCR master mix (5 μL; Agilent Technologies), target forward primer (200 nM), target reverse primer (200 nM), cDNA synthesis reaction (1 μL), and nuclease-free PCR-grade water to adjust the final volume. The PCR amplification was carried out in an Eco Real-Time PCR System (Illumina Incorporated, San Diego, CA, USA). Thermal cycling conditions were 95°C for 10 min, followed by 40 repetitive cycles at 95°C for 30 s, and 60°C for 1 min. All reactions were performed in triplicate. In each experiment, the amount of gene expression was recorded as CT values that corresponded to the number of cycles where the fluorescence signal can be detected above a threshold value. The CT averages for each biological replicate were calculated and transformed into relative values through the ΔΔCT formula (24 (link)).