To visualise microglia, anti-Iba1 (1:100, WAKO) and anti-rabbit Alexa Fluor 488 (1:1000, Invitrogen) were used. For F4/80 expression, anti-F4/80 (1:400, Abcam) was used followed by anti-rat Alexa 488 or 568 (both 1:1000, Invitrogen). For CCL2 in the sciatic nerve, anti-CCL2 (1:200, Invitrogen) and anti-rabbit Alexa 568 (1:1000, Invitrogen) were used. P-ERK visualisation in DRG was carried out using anti-p-ERK (1:300, Cell Signaling Technology) followed by anti-rabbit Alexa 568 (1 in 1000 Invitrogen). GFP did not require amplification. In all cases, control staining was performed in which no primary antibody was applied.
Alexa 568
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Japan
Alexa 568 is a fluorescent dye used in various applications in life science research. It has an absorption maximum of 578 nm and an emission maximum of 603 nm, making it suitable for detection and labeling in fluorescence-based techniques.
Automatically generated - may contain errors
Lab products found in correlation
Alexa 488, by Thermo Fisher Scientific (183 mentions)
Alexa 647, by Thermo Fisher Scientific (59 mentions)
4 6 diamidino 2 phenylindole (dapi), by Merck Group (20 mentions)
Lsm 710 confocal microscope, by Zeiss (13 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (12 mentions)
Alexa 633, by Thermo Fisher Scientific (11 mentions)
Triton x 100, by Merck Group (9 mentions)
Vectashield, by Vector Laboratories (9 mentions)
Lsm 880, by Zeiss (8 mentions)
Lsm 700, by Zeiss (7 mentions)
Alexa 594, by Thermo Fisher Scientific (6 mentions)
Alexa 555, by Thermo Fisher Scientific (6 mentions)
Bovine serum albumin (bsa), by Merck Group (6 mentions)
Lsm 710, by Zeiss (6 mentions)
Prolong gold antifade reagent, by Thermo Fisher Scientific (6 mentions)
Fluoromount g, by Southern Biotech (5 mentions)
Normal goat serum (ngs), by Thermo Fisher Scientific (5 mentions)
Alexa 488 conjugated secondary antibody, by Thermo Fisher Scientific (4 mentions)
Lsm 880 confocal microscope, by Zeiss (4 mentions)
4 6 diamidino 2 phenylindole (dapi), by Vector Laboratories (4 mentions)
337 protocols using alexa 568
1
Immunohistochemical Staining of Microglia and Inflammatory Markers
2
Immunoglobulin Detection Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Goat anti-mouse immunoglobulins, conjugated to horseradish peroxidase (Sigma, A3673); used for western blotting in a 1:10,000 dilution. Chicken anti-mouse immunoglobulins conjugated to Alexa488 (Invitrogen; #A21200), used for IF microscopy in a 1:10,000 dilution. Donkey anti-rabbit immunoglobulins conjugated to Alexa568 (Invitrogen; #A10042), used for IF microscopy in a 1:10,000 dilution. Donkey anti-mouse immunoglobulins conjugated to Alexa568 (Invitrogen; #A10037), used for IF microscopy in a 1:10,000 dilution. Chicken anti-rabbit immunoglobulins conjugated to Alexa488 (Invitrogen; #A21441), used for IF microscopy in a 1:10,000 dilution. Monovalent Fab fragments rabbit anti-mouse (unconjugated; Fab rabbit anti-mouse IgG (H&L); Rockland Immunochemicals, #810-4102 via Biomol GmbH, Hamburg, Germany), used for IF microscopy in a 1:50 dilution.
3
Immunofluorescence and Western Blot Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Secondary antibodies for immunofluorescence microscopy: Chicken anti‐mouse immunoglobulins conjugated to Alexa488 (Invitrogen, Carlsbad, CA, USA, #A21200). Donkey anti‐mouse immunoglobulins conjugated to Alexa568 (Invitrogen, #A10037). Donkey anti‐rabbit immunoglobulins conjugated to Alexa568 (Invitrogen, #A10042). Chicken anti‐rabbit immunoglobulins conjugated to Alexa488 (Invitrogen, #A21441). Goat anti‐mouse immunoglobulins conjugated to Alexa647 (Invitrogen, #A21236). Monovalent Fab fragments rabbit anti‐mouse [unconjugated; Fab rabbit anti‐mouse IgG (H&L); Rockland Immunochemicals, #810‐4102 via Biomol GmbH, Hamburg, Germany], used for immunofluorescence microscopy in a 1:50 dilution. Chicken anti‐goat immunoglobulins conjugated to Alexa594 (Invitrogen, #A21468). Secondary antibodies for Western blot analyses: goat anti‐rabbit immunoglobulins conjugated to peroxidase (Sigma, #A6154), used in a 1:5,000 dilution for Western blot analyses; goat anti‐mouse immunoglobulins conjugated to peroxidase (Sigma, #A3673), used in a 1:5,000 dilution for Western blot analyses.
4
Immunohistochemistry Protocol for Drosophila Brains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary antibodies used for immunohistochemistry were: rat anti-N-Cadherin extracellular domain (DN-Ex #8; 1:2088 (link), 1997, DSHB); rabbit anti-GFP (1:1000; Molecular Probes); and mouse anti-CD2 (1:1000; Molecular Probes). Secondary antibodies used were as follows (all 1:300): goat anti-rabbit F(ab)′ fragment coupled to Alexa 488 (Molecular Probes), goat anti-mouse F(ab)′ fragment coupled to Alexa 568 (Molecular Probes), goat anti-mouse F(ab)′ fragment coupled to Alexa 568 highly cross-absorbed (Molecular Probes), goat anti-rat F(ab)′ fragment coupled to Alexa 568 (Molecular Probes), goat anti-rat F(ab)′ fragment coupled to Alexa 647 (Molecular Probes) and Toto-3 (1:2000, Molecular Probes). Immunostaining of brains of adult flies and pupae were carried out essentially as described previously89 (link) with the following exceptions: (1) adult brains were fixed in 2% PFA for 90 min, and (2) for the dissection of the pupal brains, the pupal cases were open, 2% PFA was added, and the brains were allowed to fix for 10 min before further dissection in 2% PFA. The overall time of fixation in 2% PFA was 90 min. Fluorescent samples were analyzed using a Zeiss Meta510 confocal microscope.
5
Immunostaining of Imaginal Discs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Imaginal discs were prepared and stained using standard procedures. Briefly, larvae were dissected in cold PBS and fixed in 4% paraformaldehyde (PFA) in PBS for 20 min. Washes were performed in PBS + 0.03% Triton X-100 (PBT) and blocking in PBT + 2% normal donkey serum (PBTN). Samples were incubated with primary antibodies overnight at 4˚C. The primary antibodies used: mouse anti-Wingless (1:2000, was deposited to the DSHB by Cohen, S.M.
(DSHB Hybridoma Product 4D4)), rat anti-DE-Cadherin (1:30, was deposited to the DSHB by Uemura, T. (DSHB Hybridoma Product DCAD2)), rabbit anti-phospho-Myosin light chain 2 (Ser19) (1:50, Cell Signaling Technology #3671), rabbit anti-Ap (1:1000, described in [52] ).
Incubation with secondary antibodies were at room temperature, for 2hr. The secondary antibodies used: anti-mouse Alexa 568 (1:700, ThermoFisher) and Alexa 633 (1:700, ThermoFisher), anti-rat Cy3 (1:300, Jackson ImmunoResearch) anti-rabbit Alexa 568 (1:600, ThermoFisher) and Alexa 633 (1:600, ThermoFisher). Discs were mounted in Vectashield antifade mounting medium with Dapi (Vector Laboratories). For F-actin staining Phalloidin-Tetramethylrhodamine B (Fluka #77418) was added during incubation with secondary antibodies at the concentration 0.3 μM.
(DSHB Hybridoma Product 4D4)), rat anti-DE-Cadherin (1:30, was deposited to the DSHB by Uemura, T. (DSHB Hybridoma Product DCAD2)), rabbit anti-phospho-Myosin light chain 2 (Ser19) (1:50, Cell Signaling Technology #3671), rabbit anti-Ap (1:1000, described in [52] ).
Incubation with secondary antibodies were at room temperature, for 2hr. The secondary antibodies used: anti-mouse Alexa 568 (1:700, ThermoFisher) and Alexa 633 (1:700, ThermoFisher), anti-rat Cy3 (1:300, Jackson ImmunoResearch) anti-rabbit Alexa 568 (1:600, ThermoFisher) and Alexa 633 (1:600, ThermoFisher). Discs were mounted in Vectashield antifade mounting medium with Dapi (Vector Laboratories). For F-actin staining Phalloidin-Tetramethylrhodamine B (Fluka #77418) was added during incubation with secondary antibodies at the concentration 0.3 μM.
6
Fluorescent Ribosomal Subunit Reconstitution
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S6-Alexa488/L9-Alexa568 ribosomes were prepared as previously described [24, 27] .
Single cysteine mutants of the small ribosomal subunit protein S6 and large ribosomal subunit protein L9 were labeled using maleimide derivatives of Alexa488 and Alexa568, respectively (Thermo Fisher Scientific, Waltham, MA). Labeled S6 and L9 proteins were incorporated into DS6 30S and DL9 50S subunits, respectively, by partial reconstitution as previously described [24, 27] .
Fluorescein labeled mRNAs were synthesized by Integrated DNA Technologies (Coralville, IA). mRNA variants were derived from the mRNA with 4-nucleotide spacer between SD and AUG codon [33] (5' GGCAAGGAGGUAAAAAUGUACAAAGUAUAA 3' Fluorescein; SD sequence and AUG codon are underlined): 5' GGCAAGGAGGUACACAAAUGUACAAA 3'Fluorescein (6 nt spacer); 5' GGCAAGGAGGUACACAAAAUGUACAAA 3'Fluorescein (7 nt spacer); 5' GGCAAGGAGGUACAACACAAAAUGUACAAA 3'Fluorescein (10 nt spacer); 5' GGCAAGGAGGUAACAACACAAACAAAUGUACAAA 3'Fluorescein (14 nt spacer). We also measured the rate of translocation of leaderless mRNA (5' AUGUACAAAGUAUAA 3' Fluorescein) that does not contain SD sequence.
Single cysteine mutants of the small ribosomal subunit protein S6 and large ribosomal subunit protein L9 were labeled using maleimide derivatives of Alexa488 and Alexa568, respectively (Thermo Fisher Scientific, Waltham, MA). Labeled S6 and L9 proteins were incorporated into DS6 30S and DL9 50S subunits, respectively, by partial reconstitution as previously described [24, 27] .
Fluorescein labeled mRNAs were synthesized by Integrated DNA Technologies (Coralville, IA). mRNA variants were derived from the mRNA with 4-nucleotide spacer between SD and AUG codon [33] (5' GGCAAGGAGGUAAAAAUGUACAAAGUAUAA 3' Fluorescein; SD sequence and AUG codon are underlined): 5' GGCAAGGAGGUACACAAAUGUACAAA 3'Fluorescein (6 nt spacer); 5' GGCAAGGAGGUACACAAAAUGUACAAA 3'Fluorescein (7 nt spacer); 5' GGCAAGGAGGUACAACACAAAAUGUACAAA 3'Fluorescein (10 nt spacer); 5' GGCAAGGAGGUAACAACACAAACAAAUGUACAAA 3'Fluorescein (14 nt spacer). We also measured the rate of translocation of leaderless mRNA (5' AUGUACAAAGUAUAA 3' Fluorescein) that does not contain SD sequence.
7
Drosophila Brain Immunostaining and Imaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The experimental procedures for brain dissection, fixation, and immunostaining as well as agarose section were as described previously (Hakeda-Suzuki et al., 2011 (link)). The following primary antibodies were used: mAb24B10 (1:50, DSHB), rat antibody to CadN (Ex#8, 1:50, DSHB), mouse antibody to Repo (8D12, 1:20, DSHB) mouse antibody to myc (4E10, 1:100, Santa Cruz), rabbit antibody to RFP (1:500 ROCKLAND), rabbit antibody to GFP conjugated with Alexa488 (1:200, Life technologies). The secondary antibodies were Alexa488, Alexa568, or Alexa633-conjugated (1:400, Life technologies). Images were obtained with Nikon C2+ and A1 confocal microscopes and processed with Adobe Photoshop and Illustrator.
Live imaging was done according to Özel et al., 2015 (link). Images were obtained with Zeiss LSM880NLO + COHERENT Chameleon Vision.
Live imaging was done according to Özel et al., 2015 (link). Images were obtained with Zeiss LSM880NLO + COHERENT Chameleon Vision.
8
Indirect Immunofluorescence of Embryo Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Embryos were fixed in 4% formaldehyde, phosphate buffer pH 7.4 as previously described [45 (link)]. The primary antibodies used for indirect immunofluorescence were as follows: guinea pig anti PATJ (1 : 500, [30 (link)]), mouse anti Sdt (1 : 20, [42 (link)]), rabbit anti Sdt (1 : 2000, this study), rabbit anti Baz (1 : 1000, [43 (link)]), mouse anti Crb (Cq4, 1 : 50, DSHB), mouse anti Dlg (1 : 50, DSHB), rabbit anti GFP (#A11122, 1 : 1000, Life Technologies) and chicken anti GFP (1 : 2000, Aves Laboratories). Secondary antibodies conjugated with Alexa 488, Alexa 568 and Alexa 647 (Life Technologies) were used at 1 : 400.
Images were taken on a Zeiss LSM 710 Meta confocal microscope and processed using Adobe Photoshop.
Images were taken on a Zeiss LSM 710 Meta confocal microscope and processed using Adobe Photoshop.
9
Visualizing Protein Localization in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfected HeLa cells were fixed, washed and blocked as described (22 (link)), prior to staining with primary antibodies. Subsequent staining was with wheat germ agglutinin (WGA)-FITC (Sigma) and/or secondary antibodies conjugated to Alexa488, Alexa568, or Alexa647 (Life Technologies). Images were captured on a Zeiss LSM 710 confocal microscope using a 40× objective.
10
Pharmacological Reagents Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reagents were purchased from Sigma except for isradipine, L–NNA, DTT, ryanodine, orexin, muscimol, and CGP37157 were purchased from R&D Systems; TMRM, Alexa568, Alexa594, and Fluo4 obtained from Life Technologies; genipin was obtained from Wako Reagents, and Ru360 obtained from EMD Biosciences. L–NAME was purchased from Sigma–Aldrich. Drugs stock solutions were prepared in deionized water, DMSO, ethanol, or methanol as instructed by manufacturer on the day of experiment. Stocks were diluted to final concentrations in ACSF to achieve a final solvent concentration of <0.01% v/v.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!