A piece of each E15 embryo head (3 mm3) was used for genotyping. DNA was extracted with the SYBR Green Extract-N-Amp tissue PCR kit (Sigma), then, quantitative PCR (qPCR) was performed using the 7500 fast RT-PCR system and analysed following the manufacturer’s instructions (Applied Biosystems). The gender of each embryo was determined using the male Sry [NM_012772] primers [10 (link)] (F: 5′-GAGAGAGGCACAAGTTGGC-3′; R: 5′-GCCTCCTGGAAAAAGGGCC-3′). The genotyping of each embryo was determined using the Pmp22 [NM_008885] primers [5 (link)]. PCR was performed (20 s at 95°C, 45 cycles of 10 s at 95°C, 10 s at 65°C then 30 s at 72°C) with the 7500 fast RT-PCR system (Applied Biosystems).
7500 fast rt pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, Switzerland, China
The 7500 Fast RT-PCR system is a real-time PCR instrument designed for fast and efficient gene expression analysis. It features a compact, benchtop design and supports a wide range of sample formats, enabling researchers to perform sensitive and accurate quantitative analysis of target genes.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (22 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (8 mentions)
Rneasy mini kit, by Qiagen (7 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Iscript cdna synthesis kit, by Bio-Rad (5 mentions)
Sybr green, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
One step sybr primescript rt pcr kit, by Takara Bio (4 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Dnase 1, by Thermo Fisher Scientific (4 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Iscript cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Rneasy kit, by Qiagen (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr mix, by Thermo Fisher Scientific (2 mentions)
Superscript 3 first strand synthesis system for rt pcr, by Thermo Fisher Scientific (2 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (2 mentions)
Rna stat 60, by AMS Biotechnology (2 mentions)
Taqman universal master mix 2, by Thermo Fisher Scientific (2 mentions)
91 protocols using 7500 fast rt pcr system
1
Genotyping of E15 Embryo Heads
2
COVID-19 Diagnosis in Assiut Hospitals
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A cross-sectional study has been conducted at Assiut University and Assiut Police Hospitals from July 2021 to February 2022. Patients who were enrolled in this study were either from patients admitted to the hospitals or those who went to the outpatient’s clinics. Diagnosis of COVID-19 infection among the participants was established according to the WHO and Egyptian Ministry of Health and Population (MOHP) guidelines [7 , 8 ]. The cornerstone for diagnosis were RT-PCR and MSCT chest. Case detection was done using RT-PCR for the viral RNA by TaqMan™ 2019-nCoV Control Kit v1 (Cat. No. A47532) supplied by QIAGEN, Germany on the Applied Biosystem 7500 Fast RT PCR System, USA. All patients admitted during the study period in study hospitals with confirmed COVID-19 infection and met the inclusion criteria were included in this study.
The inclusion criteria were adult patients aged 18 years or older, of both genders who were diagnosed as COVID-19-positive by RT-PCR in Assiut University and Assiut Police hospitals during the study period who had chest CT scan examination during acute stage of the diseases. Children under 18 years old, patients who were not examined by CT scan of the chest and those who refused to participate in the study were excluded.
The inclusion criteria were adult patients aged 18 years or older, of both genders who were diagnosed as COVID-19-positive by RT-PCR in Assiut University and Assiut Police hospitals during the study period who had chest CT scan examination during acute stage of the diseases. Children under 18 years old, patients who were not examined by CT scan of the chest and those who refused to participate in the study were excluded.
3
Quantitative Analysis of TaGW2-6A Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from immature seed (15 DAP = days after pollination) from 10 genotypes (5 genotypes with SNP-494_A and 5 genotypes with SNP-494_G) using Sigma Aldrich’s Spectrum Plant Total RNA kit. Quantitative Real-time PCR (qRT-PCR) was used to analyze the transcript level of TaGW2-6A (primer sequences: TaGW2-6A_For: AAGCATGGGTGCTGCGGAA, TaGW2-6A_Rev: GTCAGCAAAAGGCAACGGTA [30 (link)]). qRT-PCR was performed with Thermo Scientific’s DyNAmo Flash SYBR Green qPCR kit, using Applied Biosystem’s 7500 Fast RT-PCR System according to the manufacturer’s instructions. qRT-PCR reaction was set up with the following thermal profile using a ramp at the rate of 3.5°C/second: 95°C for 15 min (initial denaturation), followed by 40 cycles with 95°C for 10 s (denaturation) and 60°C for 30 s (annealing/extension). The relative transcript level of TaGW2-6A was calculated using 2− ΔΔCT method [31 (link)]. TaActine gene (primer sequences TaActine_For: CACTGGAATGGTCAAGGCTG, TaActine_Rev: CTCCATGTC ATCCCAGTTG) was used as internal control and HI 1500 genotype (with minimum expression level) was used as a reference. For expression analysis, two biological replications for each genotype were performed and three technical replications were analyzed for each biological replication.
4
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from BMDMs using an RNeasy kit (Qiagen). Complementary DNA (cDNA) was prepared from total RNA using the iScript cDNA synthesis kit (Bio-Rad). Gene expression was analyzed by real-time polymerase chain reaction (qPCR) using the Applied Biosystems 7500 Fast RT-PCR system and Fast SYBR Green Master Mix (Life Technologies). Experiments were performed using qPCR primers designed and purchased from Integrated DNA Technologies: m36B4 (5′TCATCCAGCAGGTGTTTGACA3′ and 5′GGCACCGAGGCAACAGTT3′, efficiency 98.55%, slope ), As3mt (5′GAAAACTGCCGAATTTTGGA3′ and 5′GCCGTGGAGAAAAGTCACAT3′, efficiency 97.99%, slope ). Primers were validated using standard curves over 5 logs of murine C57BL6 liver cDNA. Only primers with single peaks (and no primer dimers) in melt curves were used. Experiments were performed using three technical replicates. Data were normalized to the housekeeping gene m36B4. Fold change in gene expression was determined by the method using naïve gene expression as the reference sample.
5
Quantifying NRF1 and NFE2L1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell pools after treatment with the NPs using the RNA isolation kit, following the manufacturer’s protocol (Sigma-Aldrich, Madrid, Spain). The concentration and purity of the RNA were assessed by measuring the 260/280 ratio and 260/ 230 ratio using NanoDrop™ 2000 (Thermo Fisher Scientific, Waltham, MA, USA). Briefly, 1 μg of RNA was used to synthesize cDNA with the help of a kit (Thermo Scientific, Rockford, IL, USA) and the cDNA obtained was employed for RT-PCR analysis (7500 Fast RT-PCR system, Life technologies, Camarillo, CA, USA). Expression of NRF1 and NFE2L1 was assessed using SYBR Select Master Mix (Applied Biosystems, Beverly, MA, USA). GAPDH gene (Sigma-Aldrich, Madrid, Spain) expression was used as the endogenous control. The following primer (Sigma-Aldrich, Madrid, Spain) sequences were employed:
NRF1, 5’-CGGGACAGAGTCACCATTTGA-3’ and 3’-GGGGCACTGTACAGGATTTCA-5’ NFE2L1, 5’-CGGGACAGAGTCACCATTTGA-3’ and 3’-GGGGCACTGTACAGGATTTCA-5´ GAPDH, 5’-CGCATCTTCTTTTGCGTCG-3’ and 3’-TTGAGGTCAATGAAGGGGTCA-5’. Relative quantification was performed according to the comparative 2−ΔΔCt method.
NRF1, 5’-CGGGACAGAGTCACCATTTGA-3’ and 3’-GGGGCACTGTACAGGATTTCA-5’ NFE2L1, 5’-CGGGACAGAGTCACCATTTGA-3’ and 3’-GGGGCACTGTACAGGATTTCA-5´ GAPDH, 5’-CGCATCTTCTTTTGCGTCG-3’ and 3’-TTGAGGTCAATGAAGGGGTCA-5’. Relative quantification was performed according to the comparative 2−ΔΔCt method.
6
Thermal Shift Assay Protocol for Protein-Ligand Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Thermal shift assays typically followed the protocol as described in ref. 29 (link). Briefly, 100 μl of protein (∼5 μg) in 50 mM HEPES (pH7.6), 300 mM NaCl, 5% glycerol and 1 mM DTT was incubated with 20 mM MgCl2 and 0–10 μM ATP for 30 min at 4 °C in the presence of 5 × Sypro Orange dye (Sigma-Aldrich). From the 100 μl reaction mixture per condition, 4 × 20 μl was loaded onto RT–PCR plates in technical quadruplicates. Melting curves were then assessed in an Applied Biosystems 7500 Fast RT–PCR system (Life Technologies). Temperature was cycled up from 25 to 95 °C in 1 °C min−1 increments, with measurements taken every 0.5 °C.
Curves were trimmed manually and a Boltzmann Sigmoidal curve was fitted to the data in GraphPad Prism. The inflection point of the curve, Tm, was taken from all conditions. The average Tm value of the untreated control replicates was subtracted from the values of the treated wells to obtain the difference in Tm caused by ATP binding, termed the ΔTm value.
Curves were trimmed manually and a Boltzmann Sigmoidal curve was fitted to the data in GraphPad Prism. The inflection point of the curve, Tm, was taken from all conditions. The average Tm value of the untreated control replicates was subtracted from the values of the treated wells to obtain the difference in Tm caused by ATP binding, termed the ΔTm value.
7
Semi-Quantitative Analysis of hANGPT1 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At 48 h post-transfection, total RNA was extracted using the TRIzol reagent (Aidlab Biotechnologies Co., Ltd, Beijing, China), cDNA was obtained by reverse transcription and the mRNA expression of the hANGPT1 gene was semi-quantitatively analyzed using the Applied Biosystems 7500FAST RT-PCR system and SYBR Green (Thermo Fisher Scientific, Inc.). The primers were as follows: hANGPT1, forward 5′-CGTGGAACCGGATTTCTCTT-3′ and reverse 5′-GTACTGCCTCTGACTGGTAATG-3′; and GAPDH, forward 5′-CAAGGTCATCCATGACAACTTTG-3′ and reverse 5′-GTCCACCACCCTGTTGCTGTAG-3′. The reaction conditions were 50°C for 2 min, 95°C for 10 min and then 40 cycles of 95°C for 30 sec and 60°C for 30 sec. PCR products were electrophoresed on a 1% agarose gel and stained with ethidium bromide. GAPDH was used to normalize cDNA from different samples. The relative expression of hANGPT1 to GAPDH was semi-quantified by a gel imaging analysis system (Geliance 200; Perkin Elmer, Inc.).
8
Evaluating Autophagy-related Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used Trizol to extract total RNA. RNA concentration was measured with NanoDrop 2000 (Thermo Scientific, Waltham, Massachusetts, USA). PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TaKaRa, Japan) was used to synthesis cDNA. The sequence of the forward and reverse primers is listed as follows: LC3 Fw primer: 5′-AGGATGCCCTCTTCTTCTTTG-3′, Rev primer: 5′-GAAATAGTCCTCCTCGT GATGTT-3′; Beclin1 Fw primer: 5′-ACAGGAACGACAATGAGT GAG-3′, Rev primer: 5′-TCCGTAGATGGGCAAAGATAAC-3′; NADH dehydrogenase (ubiquinone) ferrithionein 3(NDUFS3) Fw primer: 5′-GCTCG CATCTCTCCGATTT-3′, Rev primer: 5′-AATAAGCACCTCCAGCTCATC-3′.
The real-Time PCR (RT-PCR) reaction system included: 4 ng cDNA, 5 pmol primer, 5 μL Power SYBR Green Master Mix (Thermo Fisher Scientific, USA), 3 μLRNase Freed H2O. SYBR Green was used to detect double-stranded DNA. The PCR amplification was carried out using Applied Biosystems device (7500Fast RT-PCR system, Thermo Fisher Scientific) under the following conditions: 40 cycles of 10 min at 95 °C, 15 s at 95 °C and 1 min at 60 °C. 18 s acted as an endogenous control for data normalization. Relative mRNA expression was determined by the 2−△△Cq method [14 (link)]. Relative quantitative analysis of data was conducted with the GraphPad Prism 8 software.
The real-Time PCR (RT-PCR) reaction system included: 4 ng cDNA, 5 pmol primer, 5 μL Power SYBR Green Master Mix (Thermo Fisher Scientific, USA), 3 μLRNase Freed H2O. SYBR Green was used to detect double-stranded DNA. The PCR amplification was carried out using Applied Biosystems device (7500Fast RT-PCR system, Thermo Fisher Scientific) under the following conditions: 40 cycles of 10 min at 95 °C, 15 s at 95 °C and 1 min at 60 °C. 18 s acted as an endogenous control for data normalization. Relative mRNA expression was determined by the 2−△△Cq method [14 (link)]. Relative quantitative analysis of data was conducted with the GraphPad Prism 8 software.
9
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the present study, whole-cell RNA was extracted using TRIzol® reagent (Beijing Solarbio Science & Technology Co., Ltd.), RNA concentration was detected using a Nanodrop Spectrophotometer (Thermo Fisher Scientific, Inc.) at a wavelength of 260 nm, and intracellular RNA expression levels were measured using RT-qPCR. DANCR and GAPDH expression was analyzed using HiScript III RT Supermix for qPCR and ChamQ Universal SYBR qPCR Master mix (Vazyme Biotech Co., Ltd.) according to the manufacturer's instructions, Briefly, initial denaturation at 95°C for 30 sec was followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. MiRNA-33b and U6 expression was quantified using miRNA 1st Strand cDNA Synthesis kit (stem-loop) and miRNA Universal SYBR qPCR Master mix (Vazyme Biotech Co., Ltd.) according to the manufacturer's instructions. MiRNA-33b primers were designed by software provided by the manufacturer of the miRNA reverse transcription kit, and the universal reverse primer in the kit was used. All RT-qPCR reactions were performed using the 7500 fast RT-PCR System (Thermo Fisher Scientific, Inc.). Finally, each expression was calculated through the 2−ΔΔCq method (24 (link)). The primers used in the present study are listed in Table SI .
10
SARS-CoV-2 RNA Extraction and Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction and nucleic acid purification are performed using MagMAX™ viral/pathopen nucleic acid isolation kit and KingFisher™ Flex system (Thermofisher, MA, USA). COVID-19 real time RT-PCR was performed using Applied Biosystems™ 7500 Fast RT-PCR system (Thermofisher, MA, USA) as described previously [10 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!