Revertaid first stand cdna synthesis kit

Expressions of LPL and CD36 in heart tissues were determined by reverse transcriptase polymerase chain reaction (RT-PCR). Heart tissues near infarct zone were excised and frozen in liquid nitrogen. Total RNA was extracted using Trizol Reagent (Gibco-BRL, Paisley, UK). The concentration of RNA was measured by Nano Drop 2000 (Thermo Scientific, USA). RNA was transcribed using the RevertAidTM First Stand cDNASynthesis kit (Fermentas, LT). RNAs quantities of LPL, CD36 and GAPDH were analyzed by PCR. The reaction system contained 2 μl cDNA, 0.5 μl forward and reverse primers, 10 μl Rox and 7 μl DEPC water. PCR conditions were set as follows: 15 s at 95 °C for denaturation, 1 min at 55 °C for annealing and extension. 40 cycles of amplifications were performed for each gene. The sequences of the primers were shown at Table 1. Quantities of LPL and CD36 mRNA were normalized to mRNA quantities of GAPDH.Table 1

Nucleotide sequences of primers used in real-time PCR

Gene (accession no.)	Primes	Nucleotiede sequences5‘-3’	Length (bp)	Temp (°C)
LPL	Forward	CGCTCCATCCATCTCTTC		57.3
	Reverse	GGCTCTGACCTTGTTGAT	159	55.0
CD36	Forward	GGTCCTTACACATACAGAGT		55.8
	Reverse	CCACAGCCAGATTGAGAA	163	55.0
GAPDH	Forward	TCAACGGCACAGTCAAG		55.0
	Reverse	TACTCAGCACCAGCATCA	116	55.0

RNA was extracted from the collected wheat leaves using the TRIzol reagent method (Invitrogen, Carlsbad, CA, USA), according to the guidelines of the manufacturer. The quality of RNA was determined by gel electrophoresis. Additionally, the RNA concentration was determined using a NanoDrop™1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The cDNA was produced from 2 µg of total RNA with oligo (dt)18 primers using the RevertAid First Stand cDNA Synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA; Available online: www.thermofisher.com/order/catalog/product/K1621) following the manufacturer’s instructions. On the basis of the subgenomic alignment to assess Pst expression, we designed specific primers from subgenomes 2A, 2B and 2D, and then qRT-PCR was performed (Figure 3). The expression of TaATG8j-2AS, TaATG8j-2BS and TaATG8j-2DS in relation to the compatible and incompatible interactions between wheat and Pst was quantified using qRT-PCR performed on a CFX Connect™ Real-time PCR Detection System (Singapore). The relative expression was controlled using the wheat elongation factor gene TaEF-1α (GenBank accession no. Q03033) and was quantified using the comparative 2^−ΔΔCt method [43 (link)]. All reactions were performed in triplicate and with three biological replications. The primers used for qRT-PCR are listed in Table S1.

Total RNA was extracted from 100 mg of plant tissue, leaves, stems and roots at 75 and 125 DAT. The plant samples were ground in liquid nitrogen with mortar and pestle. The procedure was followed by GeneJET plant RNA Purification Mini Kit (Thermo Scientific) and then RNA was treated with DNaseI (Thermo Scientific). Total RNA was determined using Denovix DS-11 Spectophotometer (DeNovix, USA) at 260 nm and 280 nm for quantity and quality RNA, respectively, and was examined with 1% of agarose gel electrophoresis.
cDNA was performed by RevertAid first stand cDNA synthesis kit (Thermo Scientific) using 0.5 μg of total RNA mixed with 1 μl of oligo (dT)18 primer for the first strand synthesis. The mixture was incubated at 65°C for 5 minutes. After incubation, the second strand cDNA was synthesized in a reaction mixture as follows: 4 μl of 5X Reaction Buffer, 1 μl of RiboLock RNase Inhibitor (20 U/μl), 2 μl of 10 mM dNTPs Mix and 1 μl of RevertAid M-MuLV RT (200 U/μl). The reaction was incubated at 42°C for 60 min followed by heating at 70°C for 5 minutes. The cDNAs were diluted to a final concentration of 200 ng/μl with sterile ultrapure water prior to qRT-PCR analysis.

The overnight cultures of XQ and XQW were transferred into fresh TSB at the dilution of 1:100, respectively. Bacteria at the later growth stages (6 h after inoculation) were harvested; the total RNA and corresponding cDNA were prepared using RNAprep Pure Cell/Bacteria Kit (TIANGEN) and RevertAid First Stand cDNA Synthesis Kit (Thermo Scientific), respectively. RT-qPCR was performed to detect the toxin genes (RNAIII, seb, lukF, hla, hlg, lipA, and sspA) in S. aureus strains of interest, and the expression level of genes related to biofilm formation, including nuc, fnbA, fnbB, clfA, and icaA, were also determined using primers listed in Supplementary Table S2. The relative expression levels of tested genes were normalized to that of 16S RNA gene or gyrB.

Total RNA was isolated from control (26°C) and heat-stressed leaves (45°C) using TRIzol reagent according to manufacturer protocol (Invitrogen, USA). The RNA concentration was determined on Nano drop (model Q5000 UV-Vis Spectrophotometer, Quawell, USA) by measuring the absorbance at 260 and 280 nm. Samples were stored at -80°C for later use. For first strand cDNA synthesis, 1 μg purified total RNA was used based on manufacturer protocol (RevertAid first stand cDNA synthesis kit, Thermo Scientific, Invitrogen).
Reverse transcriptase polymerase chain reaction (PCR) was used to analyze gene expression in. Tomato housekeeping gene Actin (347bp) was used as an internal control for reverse transcription PCR assay. The PCR was performed with 25 cycles (1 min at 94°C, 10 s at 94°C, 30 sec at 72°C and 5 min at 72°C) under following conditions. The 2 μL RT product was amplified in a 25-μL volume containing 2.5 μL 10X PCR buffer with MgCl₂, 0.5 μL 10 mM dNTPs and 0.2 μL Taq polymerase (company). Specific primers for Hsp100 (Solyc02g088610) (fwd: 5’-GCGACCACCTTGGATGAA-3’, rev: 5’-GGATTGCCTCTGCTACTGCT-3’) (annealing temperature 54.7°C for 10 sec) and Actin gene (GenBank: BAD86830.1) (fwd: 5’ CTCGAGCAGTGTTTCCCAGT-3’, rev: 5’-CAGAGAAAGCACAGCCTGGA -3’) (annealing temperature: 55°C for 20 sec) were designed using Primer Plus online tool.