Log In Sign up
The largest database of trusted experimental protocols

Pegfp c1 vector

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States, Canada, China

The PEGFP-C1 vector is a plasmid DNA construct designed for the expression of fusion proteins in mammalian cells. It contains the enhanced green fluorescent protein (EGFP) gene, which can be used as a reporter or tag for visualizing the localization and expression of the protein of interest.

Automatically generated - may contain errors

Lab products found in correlation

Opti mem reduced serum medium, by Thermo Fisher Scientific (3 mentions) Streptomycin, by Thermo Fisher Scientific (3 mentions) Penicillin, by Thermo Fisher Scientific (3 mentions) Dulbecco s modified eagle s medium, by Lonza (3 mentions) Ccl 1, by American Type Culture Collection (3 mentions) Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions) Anti flag, by Merck Group (1 mentions) P3xflag cmv 10 vector, by Merck Group (1 mentions) Anti flotillin 1, by Abcam (1 mentions) Anti calnexin, by Stressgen (1 mentions) 3 methyladenine 3 ma, by Merck Group (1 mentions) Anti α tubulin, by Merck Group (1 mentions) Anti p70s6k, by Cell Signaling Technology (1 mentions) Anti p p70s6k, by Cell Signaling Technology (1 mentions) Anti mtor, by Cell Signaling Technology (1 mentions) Anti p mtor, by Cell Signaling Technology (1 mentions) Anti lc3, by Merck Group (1 mentions)

Spelling variants of this product

PEGFP-C1 (33 citations)

14 protocols using pegfp c1 vector

1

Cloning RBFOX2 and MEF2D-V4 in Chicken Myoblasts

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The coding sequences of chicken RBFOX2 and MEF2D-V4 were amplified from cDNA of chicken leg muscle using PCR, and then cloned into the pEGFP-C1 vector (Invitrogen, Guangzhou, China) using the EcoRI and BamHI restriction sites.
Chicken primary myoblasts were isolated from the leg muscle of chickens at 10–11 embryo age as described previously (Luo et al., 2014 (link)). Cells were maintained in RPMI-1640 medium (Gibco, Grand Island, NY, USA) supplemented with 20% (v/v) fetal bovine serum (Gibco, Grand Island, NY, USA), and 100 μg/ml penicillin/streptomycin (Invitrogen, Guangzhou, China) at 37 °C with 5% CO2, humidified atmosphere. Cells were seeded in 12-well plates with one ml per well at 105 cells/ml. When the cells had grown to 70–80% confluence, they were transfected with plasmids (one μg/ml) of MEF2D or RBFOX2 or pEGFP-C1 vector control using lipofectamine 3,000 reagent (Invitrogen, Guangzhou, China) according to the manufacturer’s instructions.
Ouyang H., Yu J., Chen X., Wang Z, & Nie Q. (2020). A novel transcript of MEF2D promotes myoblast differentiation and its variations associated with growth traits in chicken. PeerJ, 8, e8351.
+ Open protocol
+ Expand
2

Tubby Protein Conjugation with GFP

Check if the same lab product or an alternative is used in the 5 most similar protocols
A bright green fluorescent protein (GFP) was attached to the carboxyl-terminus of tubby by standard recombinant techniques using the pEGFP-C1 vector (Invitrogen, Carlsbad, CA, USA).
Kim J.W., Kim H.S., Kim S.D, & Park J.Y. (2014). Insulin Phosphorylates Tyrosine Residue 464 of Tub and Translocates Tubby into the Nucleus in HIRcB Cells. Endocrinology and Metabolism, 29(2), 163-168.
+ Open protocol
+ Expand
3

Cloning and Expressing MPP1-GFP Mutant

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MPP1-green fluorescent protein (GFP) construct was obtained by cloning the MPP1 gene sequence into the pEGFP-C1 vector (Invitrogen, Waltham, MA) using BamHI and XhoI restriction sites. To obtain a MPP1 rescue mutant (MPP1-R), the MPP1 sequence was cloned into the p3XFLAG-CMV-10 vector (Sigma, St. Louis, MO) using HindIII and BamHI restriction sites and subsequently modified by introducing four silent mutations in the region recognized by the shRNA sequence using site-directed mutagenesis (Stratagene, Waltham, MA) (primer sequence: 5′ GGAGATGACGAGGAACATTAGCGCCAATGAGTTCTTG 3′). Abp140-17aaRuby-nos1-3′ UTR (lifeAct-Ruby) construct was a gift from M. C. Lecomte U665 INSERM Paris. Transient transfections of HEL cells were performed by CLB (Lonza, Basel, Switzerland) electroporation. Mouse monoclonal anti-MPP1 antibodies were purchased from Abnova (Taipei, Taiwan), anti-actin and anti-GFP antibodies (SantaCruz Biotechnology, Dallas, TX), anti-Flag (Sigma), anti-Flotillin-1 (Abcam, Cambridge, UK), anti-Furin Convertase (Thermo Fisher Scientific, Waltham, MA), anti-Calnexin (Stressgen, San Diego, CA).
Podkalicka J., Biernatowska A., Majkowski M., Grzybek M, & Sikorski A.F. (2015). MPP1 as a Factor Regulating Phase Separation in Giant Plasma Membrane-Derived Vesicles. Biophysical Journal, 108(9), 2201-2211.
+ Open protocol
+ Expand
4

Heterologous Expression of GABAA Receptors

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The human GABAA receptors α2, α6, β3, and γ2L cloned into pcDNA3.1 expression vectors were a generous gift from Dr. Robert L. Macdonald, Vanderbilt University, Nashville, TN. L929 cells, a mouse fibroblast cell line (CCL-1), were obtained from American Type Culture Collection (Manassas, VA). L929 cells were cultured in Dulbecco’s modified Eagle’s medium (Lonza, Basel, Switzerland) supplemented with 10% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin (Invitrogen; ThermoFisher, Grand Island, NY) and maintained in humidified 95% air and 5% CO2 at 37°C. L929 cells were transfected using FuGENE 6 (ThermoFisher) transfection reagent in Opti-MEM reduced serum medium (Life Technologies, Benicia, CA) with an equal amount of each of the subunits (1:1:1) in combination with GFP expressed from the pEGFP-C1 vector (Invitrogen). The ratio of total cDNA to transfection reagent was 2:1. Cells were detached by trypsinization 48 hours post-transfection, washed, and plated onto poly-L-lysine–coated glass coverslips. Transfected cells were identified as GFP-expressing cells using an epifluorescence microscope for electrophysiological whole-cell voltage-clamp studies. Correct incorporation of the γ subunit was tested by determining sensitivity to diazepam, a GABAA receptor positive allosteric modulator that binds at the α/γ interface as previously described (Pressly et al., 2018 (link)).
Pressly B., Lee R.D., Barnych B., Hammock B.D, & Wulff H. (2021). Identification of the Functional Binding Site for the Convulsant Tetramethylenedisulfotetramine in the Pore of the α2β3γ2 GABAA Receptor. Molecular Pharmacology, 99(1), 78-91.
+ Open protocol
+ Expand
5

Generation of GFP-tagged TDP-43 Fragments

Check if the same lab product or an alternative is used in the 5 most similar protocols
Berberine is a kind gift from Dr. Kuan-Hau Lee. 3-MA (3-Methyladenine) was purchased from Sigma Aldrich (Saint Louis, MO, USA). GFP-TDP-25: The cDNA of human hTDP-43 (NM_007375.3) was cloned into the HindIII/KpnI restriction sites of pEGFP-C1 vector (Invitrogen). For generation of the truncated C-terminal hTDP-43 fragments (pGFPC1-hTDP-25) (amino acids 175–414), the DNA primers used for PCR amplification were as follows: forward primer 5’-CGGAAGCTTCGAATTCTAAGCAAAGCCAA-3’; and reverse primer 5’-CAGGTACCCTACATTCCCCAGCCAGA-3’. The PCR product was subcloned into the pEGFP-C1 plasmid (Invitogen) using restriction sites HindIII and KpnI to generate pGFP-C1-hTDP-25 (GFP-TDP-25). Antibodies: Rabbit polyclonal anti-GFP (Invitrogen). Rabbit polyclonal anti-LC3 (Sigma Aldrich; Cell Signaling, Danvers, MA, USA). Rabbit polyclonal anti-p-mTOR, anti-mTOR, anti-p-p70S6K and anti-p70S6K (Cell Signaling). Mouse monoclonal anti-α-tubulin (Sigma-Aldrich). Mouse monoclonal anti-GAPDH (Invitrogen).
Chang C.F., Lee Y.C., Lee K.H., Lin H.C., Chen C.L., Shen C.K, & Huang C.C. (2016). Therapeutic effect of berberine on TDP-43-related pathogenesis in FTLD and ALS. Journal of Biomedical Science, 23, 72.
+ Open protocol
+ Expand
6

Recombinant Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ORF of EcTRAF4 was subcloned into the pcDNA3.1-3HA or pEGFP-C1 vector (Invitrogen) to generate the recombinant plasmids pcDNA3.1–EcTRAF4 and pEGFP–EcTRAF4, respectively. The ORF of the coat protein (CP) of RGNNV was subcloned into the pcDNA3.1-3HA vector (Invitrogen) to generate the recombinant plasmid pcDNA3.1–CP. The recombinant plasmids were confirmed with DNA sequencing. The primers used to amplify these genes are listed in Table 2.
Wu S., Sun M., Zhang X., Liao J., Liu M., Qin Q, & Wei J. (2021). Grouper TRAF4, a Novel, CP-Interacting Protein That Promotes Red-Spotted Grouper Nervous Necrosis Virus Replication. International Journal of Molecular Sciences, 22(11), 6136.
+ Open protocol
+ Expand
7

MCT2 3' UTR Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pEGFP-3’ UTR-G and A reporter vectors were constructed with the MCT2 3› UTR fragment into the pEGFP-C1 vector (Invitrogen, Paisley, UK) at the XhoI and BamHI sites for the green fluorescent protein (GFP) reporter assays. A 1.2-kb fragment containing the 3’ UTR of the human MCT2 gene was prepared by polymerase chain reaction amplification from the full-length cDNA clone. The MCT2 3’ UTR fragment was amplified from full-length MCT2 cDNA (KRIBB, Daejon, Republic of Korea) using the following primers: forward 5‘-CCGCTCGAGCGTCAAAGTTTCAAATGCACA-3’ and reverse 5‘- CGGGATCCCAAGAATCAAGATCGGGTGAA-3‘. Reporter plasmids were transfected in HEK293 and HEK293T (human embryonic kidney cells) using DharmaFECT® Duo (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer's protocol. The transfected 293T cells were grown in DMEM supplemented with 10% fetal bovine serum.
Lee J., Lee D.R, & Lee S. (2014). The genetic variation in Monocarboxylic acid transporter 2 (MCT2) has functional and clinical relevance with male infertility. Asian Journal of Andrology, 16(5), 694-697.
+ Open protocol
+ Expand
8

Cloning of Human LC3B into pEGFP-C1 Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length cDNA encoding human LC3B was amplified by polymerase chain reaction (PCR) using total DNA isolated from MCF-7 cells. PCR amplification was conducted using the following primers: human LC3B forward, 5′-GGCGAATTCGATGCCGTCGGAGAAGACCTTC-3′ and reverse, 5′-GGCGTCGACTTACACTGACAATTTCATCCC-3′. cDNA was cloned into the pEGFP-C1 vector (Invitrogen, Carlsbad, CA, USA) to generate the pEGFP-C1-LC3B plasmid.
Katagiri N., Kuroda T., Kishimoto H., Hayashi Y., Kumazawa T, & Kimura K. (2015). The nucleolar protein nucleophosmin is essential for autophagy induced by inhibiting Pol I transcription. Scientific Reports, 5, 8903.
+ Open protocol
+ Expand
9

Recombinant Expression of Human GABAA Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols
The sources and recombinant expression of the human GABAA receptors α1, α2, α4, α6, β1, β3, γ1, γ2L, and δ and the rat GABAA receptor β2 were previously described.12 Briefly, GABAA receptors were expressed in L929 cells, a mouse fibroblast cell line (CCL‐1, American Type Culture Collection, Manassas, VA). Cells were transfected using FuGENE 6 (ThermoFisher) transfection reagent with an equal amount of each of the subunits (1:1:1) in combination with green fluorescent protein (GFP) expressed from the pEGFP‐C1 vector (Invitrogen). Cells were detached by trypsinization 48 h post‐transfection, washed, and plated onto poly‐L‐lysine coated glass coverslips. Transfected cells were identified as GFP‐expressing cells, using an epifluorescence microscope for the whole‐cell voltage‐clamp studies. Correct subunit composition of the various GABAA receptors was tested by their sensitivity to diazepam, propofol, allopregnanolone, DS2, fipronil, bicuculline, and Zn2+ as previously described.12
Pressly B., Lee R.D., Singh V., Pessah I.N, & Wulff H. (2022). The seizure‐inducing plastic explosive RDX inhibits the α1β2γ2 GABAA receptor. Annals of Clinical and Translational Neurology, 9(5), 600-609.
+ Open protocol
+ Expand
10

Molecular Cloning of Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human pcDNA3.1/FLAG-MyD88, pcDNA3.1/FLAG-TRAF6, and pcDNA3.1/FLAG-p65 plasmids were provided by Professor Zhijie Chang (Tsinghua University, China). Human NOC4L were amplified from cDNA templates of HeLa cells and were further subcloned into pcDNA4.0 (Invitrogen, USA) and PC2AOE-3×FLAG expression vectors. The PC2AOE-3×FLAG vector was constructed using the overlap extension PCR method as described in a previous study69 , containing a 3×FLAG sequence following a CMV promoter. The pGEX and pNF-κB-Luc vectors were purchased from BD Biosciences-Clontech. Human TLR4 was amplified from the cDNA template of HepG2 cells and then subcloned into the pEGFP-C1 vector (Invitrogen, USA).
Qin Y., Jia L., Liu H., Ma W., Ren X., Li H., Liu Y., Li H., Ma S., Liu M., Li P., Yan J., Zhang J., Guo Y., You H., Guo Y., Rahman N.A., Wołczyński S., Kretowski A., Li D., Li X., Ren F, & Li X. (2021). Macrophage deletion of Noc4l triggers endosomal TLR4/TRIF signal and leads to insulin resistance. Nature Communications, 12, 6121.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!