RPTE cell pellets were lysed in 200 μl of NDA lysis buffer (4 M guanidine thiocyanate, 25 mM Tris, and 134 mM β-mercaptoethanol) and incubated at 56°C for 10 min, after which an equal volume of 100% ethanol was added. DNA was then bound to silica columns by centrifuging at 16,000 × g for 1 min. Columns were washed with buffer 1 (1 M guanidine thiocyanate, 25 mM Tris, pH 7, in 10% ethanol) and centrifuged, followed by a final wash in buffer 2 (25 mM Tris, pH 7, in 70% ethanol). DNA was eluted with nuclease-free water by centrifugation at 16,000 × g. Primers and probe for the BKPyV genome were designed as described in Evans et al. (39 (link)). Human tumor necrosis factor alpha (TNF-α) primers and probe were designed and obtained through TIB MolBiol (forward primer, AGGAACAGCACAGGCCTTAGTG; reverse primer, AAGACCCCTCCCAGATAGATGG; TaqMan probe, CCAGGATGTGGAGAGTGAACCGACATG). A 300 nM concentration of each primer and 50 nM TaqMan probe were used in each qPCR reaction mixture, which was run on a Rotor-Gene instrument (RG-3000; Corbett Research) and subsequently analyzed on Rotor-Gene software. BKPyV genome levels were corrected to the level of the TNF-α control for each sample, and values of uninhibited samples were arbitrarily set to 1 (6 independent experiments). A one-sample t test was conducted to give P values (standard deviations are shown with error bars).
Rotor gene instrument
Manufactured by Qiagen
Sourced in Germany
The Rotor-Gene instrument is a real-time PCR (Polymerase Chain Reaction) cycler designed for nucleic acid analysis. It features a rotating sample carousel that can accommodate multiple sample tubes or microplates. The Rotor-Gene instrument is capable of performing quantitative and qualitative PCR experiments, providing precise temperature control and real-time fluorescence detection.
Automatically generated - may contain errors
Lab products found in correlation
Magcore, by RBC Bioscience (2 mentions)
Ds 11, by DeNovix (2 mentions)
Sensifast sybr buffer, by Meridian Bioscience (2 mentions)
Dnase 1, by Omega Bio-Tek (2 mentions)
Quantitect sybr green pcr kit, by Toyobo (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Superscript 3 first strand synthesis system kit, by Thermo Fisher Scientific (1 mentions)
Rest 2009 v2, by Qiagen (1 mentions)
Nanodrop nd 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Nuclisens easymag system, by bioMérieux (1 mentions)
M2000 hiv 1 realtime system, by Abbott (1 mentions)
Artus cmv pcr kit, by Qiagen (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Qscript cdna synthesis kit, by Quanta Biosciences (1 mentions)
E z n a total rna kit 1, by Omega Bio-Tek (1 mentions)
Reverse transcriptase, by Toyobo (1 mentions)
Wizard sv gel and pcr clean up system, by Promega (1 mentions)
Qiaamp viral rna kit, by Qiagen (1 mentions)
18 protocols using rotor gene instrument
1
BKPyV Genome Quantification by qPCR
2
Quantification of LDHA Expression in Tumor Xenografts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 1mg of tumors from PC-3 and PC-3RR xenografts was collected and ground in liquid nitrogen. Immediately after liquid nitrogen evaporated, the total RNA was extracted and purified using the RNeasy Plus Mini Kit (Qiagen, VIC, Australia) according to the manufacturer's instructions. The concentrations of total RNA from tissues were measured by a ND-2000 NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE). Two micrograms (mg) of total RNA from each sample were reverse transcribed to cDNA using the SuperScript III First-strand Synthesis System Kit (Invitrogen Pty Ltd, VIC, Australia), according to the manufacturers protocol. All mRNA expression of the LDHA and β-actin gene was assessed using qRT-PCR. A Rotor-Gene instrument (Corbett Life Science, Sydney, Australia) was used for automated qRT-PCR setup of the reactions. After three independent experiments, the REST 2009 V2.0.13 (Qiagen, VIC, Australia) software was used for calculation and analysis of LDHA gene expression.
3
Epstein-Barr Virus Serological and Viral Load Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies to viral capsid antigen (immunoglobulin G [IgG] and IgM), early antigen (IgG) and Epstein-Barr nuclear antigen (IgG) were performed using ELISA methodology (DiaSorin Inc, USA) to confirm the diagnosis (15 (link)). For viral load quantitation, specimens consisting of 3 mL of anticoagulant (EDTA)-treated blood were processed and DNA extracted from whole blood samples using the NucliSENS easyMag system (bioMérieux, France). Real-time polymerase chain reaction for the measurement of viral load was performed using the RealStar EBV PCR Kit (Altona Diagnostics, Germany) and the RotorGene instrument (Corbett Life Science, Australia) (16 (link),17 ). The analytic sensitivity of the assay is 1.1 copies/μL and the detection threshold is 275 genome copies/mL of whole blood. Based on extensive experience with viral load measurements in organ transplant patients (18 (link)), viral loads of ≤6000 copies/mL were classified as low, >6000 to 30,000 as low to intermediate, >30,000 to 300,000 as intermediate to high and >300,000 copies/mL as high. The viral load assays were performed in one centre (Dr Mazzulli, Mount Sinai Hospital, Toronto).
4
Quantification of HIV, CMV, and HSV in CVL
5
COVID-19 Diagnostic Protocol in Egypt
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The participants’ age, sex, BMI, clinical symptoms, vital signs and underlying comorbidities (as hypertension, diabetes mellitus, chronic pulmonary, renal, hepatic or cardiac diseases) were obtained.
A nasopharyngeal swab was done 5 to 6 days after the first symptoms appeared. Swabs were quickly delivered to the lab in a viral transport medium. Real-time quantative reverse transcription-PCR (RT-qPCR) analysis using Taqman-based probes was performed for an in-vitro SARS-CoV-2 RNA transcription. Then, DNA amplification followed by fluorescence detection was performed. Reagents and materials used with the Rotor-Gene instrument (QIAGEN GmbH, Germany) for the analysis were obtained from VIASURE (Zaragoza, Spain).
The laboratory assessments consisted of blood count analysis, fasting blood sugar, kidney function tests, liver biochemistry tests (alanine aminotransferase, ALT; aspartate aminotransferase, AST; and total bilirubin), C-reactive Protein (CRP), D-dimer, ferritin, lactate dehydrogenase, and lipid profile analysis, which were performed within 24 h of the onset of symptoms after fasting for 12 h, and Chest computed tomography were performed at Faculty of Medicine, Cairo University Hospital, Cairo, Egypt.
A nasopharyngeal swab was done 5 to 6 days after the first symptoms appeared. Swabs were quickly delivered to the lab in a viral transport medium. Real-time quantative reverse transcription-PCR (RT-qPCR) analysis using Taqman-based probes was performed for an in-vitro SARS-CoV-2 RNA transcription. Then, DNA amplification followed by fluorescence detection was performed. Reagents and materials used with the Rotor-Gene instrument (QIAGEN GmbH, Germany) for the analysis were obtained from VIASURE (Zaragoza, Spain).
The laboratory assessments consisted of blood count analysis, fasting blood sugar, kidney function tests, liver biochemistry tests (alanine aminotransferase, ALT; aspartate aminotransferase, AST; and total bilirubin), C-reactive Protein (CRP), D-dimer, ferritin, lactate dehydrogenase, and lipid profile analysis, which were performed within 24 h of the onset of symptoms after fasting for 12 h, and Chest computed tomography were performed at Faculty of Medicine, Cairo University Hospital, Cairo, Egypt.
6
Zebrafish Embryo RNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA extracted from zebrafish embryos or cells were reverse transcribed
to cDNA by using PrimeScript RT reagent Kits (TaKaRa, Dalian, China) with
special stem-loop primer for miRNA and oligo-dT or random primer for mRNA.
qRT-PCR was performed on a Rotor-Gene instrument (Qiagen, Germany) using SYBR
Green. The primers used in the amplification were listed in the
Table
S1 and Table S2 . The housekeeping genes
U6 and gapdh were applied as internal
standards for miRNAs and mRNA, respectively. The cycling program was set as
follows: 94 °C, 15 s, 58 °C, 15 s, 72 °C, 20 s, 40 cycles. Relative abundance
was calculated by the delta-delta Ct method.
to cDNA by using PrimeScript RT reagent Kits (TaKaRa, Dalian, China) with
special stem-loop primer for miRNA and oligo-dT or random primer for mRNA.
qRT-PCR was performed on a Rotor-Gene instrument (Qiagen, Germany) using SYBR
Green. The primers used in the amplification were listed in the
S1
U6 and gapdh were applied as internal
standards for miRNAs and mRNA, respectively. The cycling program was set as
follows: 94 °C, 15 s, 58 °C, 15 s, 72 °C, 20 s, 40 cycles. Relative abundance
was calculated by the delta-delta Ct method.
7
Rapid Multiplex Respiratory Virus Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A separate flocked nasopharyngeal swab (eSwab, Copan) was used for routine testing of influenza A and B viruses, respiratory syncytial virus (triple viral test) and M. pneumoniae and collected at the discretion of the treating physician. These swabs were transported in 1 mL NaCl and used for in-house PCR tests. Results from the triple viral PCR tests were reported within a few hours but also used for comparison with the results obtained later from the samples collected and analyzed with the commercial tests (see below) as part of this study. Analysis of M. pneumoniae was performed on the nasopharyngeal samples by a probe-based lab-developed real-time PCR detecting the adhesin gene of M. pneumoniae. This PCR assay was run, analyzed, and interpreted on the Rotorgene instrument (Qiagen).
8
GSTP1 Genetic Polymorphism Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood leukocytes were the material for genetic testing. The genomic DNA was extracted from blood samples using the automatic nucleic acid extractor and genomic DNA whole blood kit (Magcore®, RBC BioScience, New Taipei City, Taiwan). The purity and concentration of the isolated DNA were evaluated spectrophotometrically at 260 nm and 280 nm (Denovix, DS-11). Analysis of the SNP (rs1695) polymorphism of the GSTP1 gene was conducted using the TaqMan qPCR method—endpoint genotyping (Assay ID C_3237198_20). In all cases, the Rotor-Gene instrument by Qiagen was used. PCR amplification using ≈ 10 ng of genomic DNA was performed with an initial step of 95 °C for 10 min followed by 50 cycles of 95 °C for 15 s (denaturation step) and 60 °C for 90 s (annealing and elongation step).
9
Chick Embryo Heart RNA Isolation and qPCR Analysis
10
Genetic Screening of GST Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood leukocytes were used as the material for genetic testing. The automatic nucleic acid extractor and genomic DNA whole blood kit (Magcore®, RBC BioScience, Forrestdale, WA, USA) were applied to extract the genomic DNA from the analyzed blood samples. The purity and concentration of the isolated DNA were evaluated spectrophotometrically at 260 nm and 280 nm (Denovix, DS-11). Analysis of the SNP (rs1695) polymorphism of the GSTP1 gene was conducted using the TaqMan qPCR method—endpoint genotyping (Assay ID C_3237198_20). The deletion of copies of genes GSTT1 (Assay ID Hs00010004_cn) and GSTM1 (Assay ID Hs02575461_cn) was analyzed using the qPCR relative quantification method with the TERT control gene. The Rotor-Gene instrument by Qiagen was used in all cases. The PCR amplification used approximately 10 ng of genomic DNA and was performed with an initial step of 95 °C for 10 min, followed by 50 cycles of 95 °C for 15 s (denaturation step) and 60 °C for 90 s (annealing and elongation step).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!