Log In Sign up
The largest database of trusted experimental protocols

Superscript 3 first strand synthesis for rt pcr

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The SuperScript III First-Strand Synthesis System is a kit for the synthesis of first-strand cDNA from RNA templates. It includes a reverse transcriptase enzyme, reaction buffer, and other necessary components.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (4 mentions) Dnase 1 amplification grade, by Thermo Fisher Scientific (2 mentions) Rlt lysis buffer, by Qiagen (1 mentions) Brilliant 2 sybr green qpcr master mix, by Agilent Technologies (1 mentions) Iq sybr supermix, by Bio-Rad (1 mentions) Easysep mouse cd4 t cell isolation kit, by STEMCELL (1 mentions) Ncode mirna first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Realplex2 instrument, by Eppendorf (1 mentions) Trizol ls, by Thermo Fisher Scientific (1 mentions) Faststart universal sybr green master mix, by Roche (1 mentions) Taq dna polymerase, by iNtRON Biotechnology (1 mentions)

Close spelling variants of this product

Superscript III First Strand Synthesis System for RT-PCR kit with oligo (dT) primers Superscript® III first strand synthesis system for the RT-PCR kit SuperScript III First-Strand Synthesis System for RT-PCR applications SuperScript III First‐Strand Synthesis System for RT‐PCR cDNA Synthesis Kit Superscript III First Strand Synthesis kit for RT-PCR SuperScript III First-Strand cDNA synthesis system for RT-PCR Superscript R III first-strand synthesis system for RT-PCR SuperScript III Transcriptor First Strand cDNA Synthesis System for RT-PCR Superscript III First-Strand Synthesis System for real-time PCR (RT–PCR) Invitrogen SuperScript® III First-Strand Synthesis System for RT-PCR

6 protocols using superscript 3 first strand synthesis for rt pcr

1

RNA Isolation and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from isolated tissue samples (25–50 mg per sample) and cells (13.5 × 106 cells per sample) was isolated using the RNeasy Mini Kit (Qiagen, 74106), including on-column DNase treatment, according to the manufacturer’s instructions, and stored at −80°C. Prior to cDNA synthesis, total RNA was treated with DNase I, Amplification Grade (Invitrogen), and cDNA was synthesised using random primers (300 ng) and Superscript III First-Strand Synthesis for RT-PCR (Invitrogen). cDNA samples were diluted 25× in nuclease-free water prior to real-time quantitative PCR (RT-qPCR) analysis.
Petit J., de Bruijn I., Goldman M.R., van den Brink E., Pellikaan W.F., Forlenza M, & Wiegertjes G.F. (2022). β-Glucan-Induced Immuno-Modulation: A Role for the Intestinal Microbiota and Short-Chain Fatty Acids in Common Carp. Frontiers in Immunology, 12, 761820.
+ Open protocol
+ Expand
2

RNA Isolation and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from cells in RLT lysis buffer (Qiagen, 79216) was isolated using the RNeasy mini Kit (Qiagen, 74106), including on-column Dnase treatment, according to the manufacturer's instructions, and stored at −80 °C. Prior to cDNA synthesis, 750 ng RNA was treated with DNase I, Amplification Grade (Invitrogen), and cDNA was synthesized using random primers (300 ng, Invitrogen) and Superscript III First-Strand Synthesis for RT-PCR (Invitrogen). cDNA samples were diluted in nuclease-free water prior to real-time quantitative PCR (RT-qPCR) analysis.
Petit J., den Brink E.V., Collén P.N., Haenen O.L., Schrama J, & Wiegertjes G.F. (2023). Green and red macroalgae extracts show antibacterial effects and induce innate immune responses in Nile tilapia and rainbow trout in vitro. Comparative Immunology Reports, 6, 200128.
+ Open protocol
+ Expand
3

RNA Extraction and RT-qPCR Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were extracted using the RNeasy mini kit (Qiagen, CA, USA) and complementary cDNA was synthesized using 2 μg of RNA in a 20 μl reaction mixture using SuperScript III First-Strand Synthesis for RT-PCR (Invitrogen, Carlsbad, CA). RT-qPCR was performed using SYBR GREEN Reagents (Brilliant® II SYBR® Green QPCR Master Mix, Agilent Technologies). All primers sets were previously screened for efficiency and their sequences were VEGF-A (F): 5′ACACATTGTTGGAAGCAGCCC-3′, (R): 5′-AGGAAGGTCAACCACTCACACACA-3′; bFGF (F): 5′-AGAAGAGCGACCCTCACATCA-3′, (R): 5′-CGGT TAGCACACACTCCTTTG-3′; GAPDH (F): 5′-GGTC TCCTCTGACTTGAACA-3′, (R): 5′-GTGAGGGTCTCT CTCTTCCT-3′. All values were normalized to GAPDH housekeeping gene and expressed as relative expression or fold change using the respective formulae 2− ΔΔCt.
Alcayaga-Miranda F., González P.L., Lopez-Verrilli A., Varas-Godoy M., Aguila-Díaz C., Contreras L, & Khoury M. (2016). Prostate tumor-induced angiogenesis is blocked by exosomes derived from menstrual stem cells through the inhibition of reactive oxygen species. Oncotarget, 7(28), 44462-44477.
+ Open protocol
+ Expand
4

Quantifying mRNA Expression in MSCs and HUVECs

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from MSCs and HUVECs was extracted following manufacturer’s instructions in the RNeasy mini kit (Qiagen, Valencia, CA, USA). Quantitative real-time PCR (RT-PCR) was carried out using an iQ SYBR Super-mix (Bio-Rad, Hercules, CA, USA) on an iQ5 real-time system [28 (link)]. In brief, cDNA was synthesized using SuperScript™ III First-Strand Synthesis for RT-PCR (Invitrogen, Carlsbad, CA, USA) and amplified using Taq DNA polymerase in the presence of primers (Table 1). The expression of target mRNA relative to Glycer-aldehyde-3-phosphate dehydrogenase (GAPDH) was calculated based on the threshold cycle (CT) as r = 2−Δ (ΔCT), where ΔCT = CT target − CT GAPDH and Δ(ΔCT) = ΔCT experimental − ΔCT control.
Wang J., Gong M., Zuo S., Xu J., Paul C., Li H., Liu M., Wang Y.G., Ashraf M, & Xu M. (2020). WNT11-Conditioned Medium Promotes Angiogenesis through the Activation of Non-Canonical WNT-PKC-JNK Signaling Pathway. Genes, 11(11), 1277.
+ Open protocol
+ Expand
5

Quantitative Analysis of miRNA and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
CD4+ T cells from spleen and lymph nodes of mice were enriched with the EasySep Mouse CD4+ T Cell Isolation Kit (Stemcell Technologies). Cells were lysed in Trizol LS (Life Technologies), total RNA was isolated, and RNA was then quantified with a ND-1000 spectrophotometer (NanoDrop). Reverse transcription of miRNA was performed with the NCode miRNA First-Strand cDNA Synthesis Kit (Life Technologies). Forward primers were the mature miRNA sequence (45 (link)) and a universal reverse primer was used from the kit. Expression values were normalized to 5.8S ribosomal RNA (F: ATCGTAGGCACCGCTACGCCTGTCTG). Reverse transcription of mRNA was performed with SuperScript III First-Strand Synthesis for RT-PCR (Invitrogen). Primers for Smad4 total transcript were CACAATGAGCTTGCATTCCAG (F) and ACCTTAAACGTCTCTCCTACCT (R). Primers for Smad4 extended transcript were CTGAGTCACTATACGAAGTGGAAT (F) and GTCATTTAGCAGAAGGTGTCTTG (R). Expression values were normalized to Gapdh (F: GTGTTCCTACCCCCAATGTGT; R:ATTGTCATACCAGGAAATGAGCTT). qPCR was performed in technical duplicates using FastStart Universal SYBR Green Master mix (Roche) on a Realplex2 instrument (Eppendorf).
Montoya M.M., Maul J., Singh P.B., Pua H.H., Dahlström F., Wu N., Huang X., Ansel K.M, & Baumjohann D. (2017). A distinct inhibitory function for miR-18a in Th17 cell differentiation. Journal of immunology (Baltimore, Md. : 1950), 199(2), 559-569.
+ Open protocol
+ Expand
6

Quantification of Firefly Luciferase Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from metastatic tissue and used as a template to produce cDNA using SuperScript III First-Strand Synthesis for RT-PCR (Invitrogen, Carlsbad, CA, USA). The synthesized cDNA was amplified using Taq DNA polymerase (iNtRON Biotechnology, Inc., Daejeon, Korea) with the fLuc primer: forward, 5′-CGC CTT GAT TGA CAA GGA TGG-3′, and reverse, 5′-GGC CTT TAT GAG GAT CTC TCT-3′. The forward rat GADPH primer was 5′-CAG TGC CAG CCT CGT CTC AT-3′ and the reverse primer was 5′-AGG GGC CAT CCA CAG TCT TC-3′.
JANG S.J., KANG J.H., LEE Y.J., KIM K.I., LEE T.S., CHOE J.G, & LIM S.M. (2016). Detection of metastatic tumors after γ-irradiation using longitudinal molecular imaging and gene expression profiling of metastatic tumor nodules. International Journal of Oncology, 48(4), 1361-1368.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!