Total RNA was extracted from the aforementioned fresh frozen tissues using the TRIzol reagent (cat. no. 15596-026; Thermo Fisher Scientific Inc.) and a tissue RNA purification kit (ES-RN002plus; Shanghai Yishan Biotechnology Co., Ltd.). Subsequently, the RNA was reverse transcribed to cDNA using the PrimeScript™ RT Master Mix kit (Takara Bio, Inc.) according to the manufacturer's instructions. RT-qPCR analysis was performed on SDS 7300 instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.) with TB Green Premix Ex Taq™ (cat. no. RR420A; Takara Bio, Inc.). The primer sequences used for the PCR were as follows: MMP-2 forward, 5'-AATGGCCGCGAATACACCAG-3' and reverse, 5'-AATGGCCGCGAATACACCAG-3'; β-tubulin forward, 5'-GTTCGATGCCCGCAATACCA-3' and reverse, 5'-CATCTTGCCCCGGTAGATGC-3'. The qPCR conditions were as follows: 95˚C for 30 sec; 40 cycles of 95˚C for 5 sec and 60˚C for 31 sec. Melting curves were used to assess and confirm the specificity of the products generated for each set of primers. Following amplification, the 2-ΔΔCq comparative method was used to analyze gene expression levels (34 (link)). The experiments were performed in triplicate.
Tb green premix ex taq
Manufactured by Thermo Fisher Scientific
Sourced in United States
TB Green Premix Ex Taq is a pre-made reagent for real-time PCR amplification and detection. It contains TB Green dye, Ex Taq DNA polymerase, dNTPs, and optimized buffer components.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt master mix, by Takara Bio (4 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Primescript rt master mix kit, by Takara Bio (2 mentions)
Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions)
Abi 7900ht real time pcr system, by Thermo Fisher Scientific (2 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rna purification kit, by EZBioscience (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Tb green premix ex taq, by Takara Bio (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Steponeplus system, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Abi 7300 pcr system, by Thermo Fisher Scientific (1 mentions)
Veriti 96 well, by Thermo Fisher Scientific (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Abi 7900, by Thermo Fisher Scientific (1 mentions)
17 protocols using tb green premix ex taq
1
Quantitative RT-PCR for MMP-2 Gene Expression
2
RT-qPCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time amplification reactions were carried out in 384-well plates using TB Green Premix Ex Taq (TaKaRa, Japan) with the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, USA).
Reactions were performed in a total volume of 10 µL comprised of 0.2 µL each primer, 5 µL TB Green Premix Ex Taq, 1 µL diluted cDNA, and 3.6 µL ddH2O. The amplification program was: 95°C for 5 min and 40 cycles of 95°C for 10 s and 55°C for 20 s. The melting curve was analyzed at 65-95°C. All RT-qPCR reactions were carried out in biological triplicates with three technical replicates.
Reactions were performed in a total volume of 10 µL comprised of 0.2 µL each primer, 5 µL TB Green Premix Ex Taq, 1 µL diluted cDNA, and 3.6 µL ddH2O. The amplification program was: 95°C for 5 min and 40 cycles of 95°C for 10 s and 55°C for 20 s. The melting curve was analyzed at 65-95°C. All RT-qPCR reactions were carried out in biological triplicates with three technical replicates.
3
Quantitative RT-PCR Analysis of TGM2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with RNAiso Plus (Takara, Tokyo, Japan). Reverse transcription was conducted using Takara PrimeScript™ RT Master Mix to obtain cDNA. Quantitative RT-PCR was performed with TB Green® Premix Ex Taq™ to determine the expression of candidate genes using an ABI 7900HT Real-Time PCR system (Applied Biosystems, CA, USA). The primer sequences are listed in Table 1 .
Primer sequences performed in the text
| TGM2 Forward | 5′-GAGGAGCGGCAGGAGTATG- 3′ |
| TGM2 Reverse | 5′-CAGGAACTTGGGGTTGACATC- 3′ |
| β-actin Forward | 5′-TTGTTACAGGAAGTCCCTTGCC- 3′ |
| β-actin Reverse | 5′-ATGCTATCACCTCCCCTGTGTG- 3’ |
4
Quantitative Analysis of Aorta RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the aorta tissue and cells using RNA Purification Kit, and
reverse-transcribed into cDNA using PrimeScript RT Reagent Kit following the standard
protocol. The Real-Time Quantitative PCR (RT-qPCR) assay was conducted using TB Green
PremixEX Taq with the Applied Biosystems 7500 Real-Time PCR System. The amplification
parameters were set at 95°C for 1 min, followed by 40 cycles of 95°C for 5 s and 58°C for
15 s, 72°C for 30 s, and 95°C for 15 s. The relative expression of mRNA was normalized to
that of β-actin. The following primers were used for PCR analysis: ββ-Actin forward,
5‘-GAGACCTTCAACACCCCAGC-3’ and reverse, 5‘-ATGTCACGCACGATTTCCC-3’; IL-1β forward,
5‘-GCTTCAGGCAGGCAGTATCA-3’ and reverse, 5‘-TGCAGTTGCTAATGGGAACG -3’; IL-6 forward,
5‘-AAAGCAGCAAAGAGGCACTG-3’ and reverse, 5‘-TACCTCAAACTCCAAAAGACCAG-3’; TNF-α forward,
5‘-CCCTCCAGAAAAGACACCATG-3’ and reverse, 5‘-CACCCCGAAGTTCAGTAGACAG-3’.
reverse-transcribed into cDNA using PrimeScript RT Reagent Kit following the standard
protocol. The Real-Time Quantitative PCR (RT-qPCR) assay was conducted using TB Green
PremixEX Taq with the Applied Biosystems 7500 Real-Time PCR System. The amplification
parameters were set at 95°C for 1 min, followed by 40 cycles of 95°C for 5 s and 58°C for
15 s, 72°C for 30 s, and 95°C for 15 s. The relative expression of mRNA was normalized to
that of β-actin. The following primers were used for PCR analysis: ββ-Actin forward,
5‘-GAGACCTTCAACACCCCAGC-3’ and reverse, 5‘-ATGTCACGCACGATTTCCC-3’; IL-1β forward,
5‘-GCTTCAGGCAGGCAGTATCA-3’ and reverse, 5‘-TGCAGTTGCTAATGGGAACG -3’; IL-6 forward,
5‘-AAAGCAGCAAAGAGGCACTG-3’ and reverse, 5‘-TACCTCAAACTCCAAAAGACCAG-3’; TNF-α forward,
5‘-CCCTCCAGAAAAGACACCATG-3’ and reverse, 5‘-CACCCCGAAGTTCAGTAGACAG-3’.
5
Gene Expression Analysis of Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expressions of IL-6, IL-10, and TNF-α at mRNA level within the mice aorta and cells were tested. RAW264.7 cells were pre-protected with THD for 0.5 h and then stimulated with LPS for 23.5 h.
Total RNA was extracted using RNA Purification Kit (EZBioscience, CN) according to the manufacturer’s instructions. 1 μg RNA was used for reverse transcription to synthesize 20 μl cDNA using PrimeScript RT Reagent Kit (TAKARA, China) according to the manufacturer’s instructions. Then 60 μl ddH2O was added to dilute it to 80 μl.
In real-time quantitative PCR (RT-PCR) using TB Green Premix EX Taq with fluorescence quantitative PCR instrument (Applied Biosystems), 4 μl of total RNA was incubated with 1 μl primer (0.1 µg/µl), 10 μl TB Green, 0.4 μl ROXII enzyme, and 4.6 µl ddH2O. PCR primers for the IL-6, IL-10, TNF-α, and β-actin were designed using online website PrimerBLAST of NCBI (National Center for Biotechnology Information) and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Detailed sequence of primers was listed inTable 2
Total RNA was extracted using RNA Purification Kit (EZBioscience, CN) according to the manufacturer’s instructions. 1 μg RNA was used for reverse transcription to synthesize 20 μl cDNA using PrimeScript RT Reagent Kit (TAKARA, China) according to the manufacturer’s instructions. Then 60 μl ddH2O was added to dilute it to 80 μl.
In real-time quantitative PCR (RT-PCR) using TB Green Premix EX Taq with fluorescence quantitative PCR instrument (Applied Biosystems), 4 μl of total RNA was incubated with 1 μl primer (0.1 µg/µl), 10 μl TB Green, 0.4 μl ROXII enzyme, and 4.6 µl ddH2O. PCR primers for the IL-6, IL-10, TNF-α, and β-actin were designed using online website PrimerBLAST of NCBI (National Center for Biotechnology Information) and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Detailed sequence of primers was listed in
6
Quantitative Gene Expression Analysis in Mouse Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After anesthesia and intracardiac perfusion with 0.1 M chilled PBS, the mouse brains were removed and gently dissected. Total RNA was extracted from the hematoma in the basal ganglion region with TRIzol (Invitrogen, Thermo Fisher, Waltham, MA, USA) following the provided directions and reverse-transcribed to cDNA using PrimeScript™ RT Master Mix (Takara BioInc, Shiga, Japan). qRT-PCR was conducted according to standard protocols using Applied Biosystems Quant Studio and TB Green Premix Ex Taq. Melting curve analysis was used to evaluate reaction specificities, and β-actin was used as a control for normalization. Gene expression was normalized to that of the control and was calculated with the 2−ΔΔCt method. Primer sequences are provided in Table 1 .
7
RT-qPCR protocol for gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells or tissues by TRIzol reagent according to the manufacturer’s instructions. According to the manufacturer’s protocol, mRNA was reversely transcribed to cDNA using PrimeScript RT Master Mix (TAKARA, Japan). Then the expression levels of mRNA in each sample was measured by TB Green Premix Ex Taq according to the supplier’s protocol in the StepOnePlus system (Applied Biosystems, United States). All tests were run for 40 cycles consisting of denaturation at 95°C for 30°s, annealing at 60°C for 30°s, and an extension at 73°C for 30°s. The relative expression of each gene was evaluated using the 2−ΔΔCt method, and Gapdh was used as the internal control. The primer pairs were used previously (Xiao et al., 2019 (link); Zhang J. et al., 2020 (link)) and are listed below: Tnf-α F: 5-CCTGTAGCCCACGTCGTAG-3, R: 5-GGGAGTAGACAAGGTACAACCC-3; Il-6 F: 5-AGTTGCCTTCTTGGGACTGA-3, R: 5-TCCACGATTTCCCAGAGAAC-3; Il-1β F: 5-GGGCCTCAAAGGAAAGAATC-3; R: 5-TACCAGTTGGGGAACTCTGC-3; Gapdh F: 5-ATTCAACGGCACAGTCAAG-3, R: 5-CTTCTGGGTGGCAGTGAT-3; Mcp-1 F: 5-ACTGAAGCCAGCTCTCTCTTCCTC-3, R: 5-TTCCTTCTTGGGGTCAGCACAGAC-3.
8
Quantitative Real-Time PCR Analysis of HELLS Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using RNAiso Plus reagent (Takara, Tokyo, Japan). The cDNA was synthesized using Takara PrimeScript™ RT Master Mix. qRT- PCR was performed with TB Green® Premix Ex Taq™ using an ABI 7900HT Real-Time PCR system (Applied Biosystems, CA, USA). The relative gene mRNA expressions were calculated by 2− ΔΔCt method with respect to GAPDH. The primer sequences are listed in Table 1 .
The sequences of primers
| Primers | Sequences (5′–3′) |
|---|---|
| HELLS Forward | ACTCCTCCTCTACTAATCTCTG |
| HELLS Reverse | GGCTGACCATTACACTTCC |
| GAPDH Forward | GCACCGTCAAGGCTGAGAAC |
| GAPDH Reverse | TGGTGAAGACGCCAGTGGA |
9
Aorta and Liver RNA Extraction and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted for the mice aorta tissue and liver tissue using RNA Purification Kit, and reverse-transcribed into cDNA using PrimeScript RT Reagent Kit following the standard protocol. The Real-Time Quantitative PCR (RT-qPCR) assay was conducted using TB Green PremixEX Taq with the Applied Biosystems 7,500 Real-Time PCR System. The amplification parameters were set at 95°C for 1 min, followed by 40 cycles of 95°C for 5 s and 58°C for 15 s, 72°C for 30 s, and 95°C for 15 s. The relative expression of mRNA was normalized to that of β-actin. All primer sequences used are listed in Table 1 .
10
Gene Expression Analysis in Leukemia Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment with DEX, HQH or a combination of DEX and HQH for 24 hours, total RNA was extracted from Nalm-6 and Jurkat cells using RNAiso Plus, according to the manufacturer’s protocol. Total RNA samples were reversely transcribed to cDNA using PrimeScript RT Master mix. qPCR was performed on a StepOnePlus Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using TB Green Premix Ex Taq. PCR products were analyzed using StepOne Software version 2.3. Specific primers were purchased from HyCell Biotechnology and the sequences are listed in Table 1 . Relative gene expression differences were calculated using the 2−ΔΔCq method and normalized to GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!